ACAP1 | GeneID:9744 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 9744 Official Symbol ACAP1
Locus N/A Gene Type protein-coding
Synonyms CENTB1; KIAA0050
Full Name ArfGAP with coiled-coil, ankyrin repeat and PH domains 1
Description ArfGAP with coiled-coil, ankyrin repeat and PH domains 1
Chromosome 17p13.1
Also Known As Arf GAP with coiled coil, ANK repeat and PH domains 1; centaurin beta1; centaurin, beta 1
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 22835

ID Symbol Protein Species
GeneID:9744 ACAP1 NP_055531.1 Homo sapiens
GeneID:216859 Centb1 NP_722483.2 Mus musculus
GeneID:287443 Acap1 XP_213365.2 Rattus norvegicus
GeneID:455275 ACAP1 XP_001169930.1 Pan troglodytes
GeneID:561771 zgc:153917 NP_001074048.1 Danio rerio
GeneID:793150 LOC793150 XP_001332838.2 Danio rerio
GeneID:836319 AGD1 NP_201004.1 Arabidopsis thaliana

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab15903 CENTB1 antibody (ab15903); Goat polyclonal to CENTB1
2 acris AP16171PU-N ACAP1 / CENTB1 (C-term); antibody Ab
3 acris AP08556PU-N ACAP1 / CENTB1 (C-term); antibody Ab
4 scbt CENTB1 CENTB1 Antibody / CENTB1 Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of ACAP1 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ACAP1 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0008060 Function ARF GTPase activator activity
GO:0046872 Function metal ion binding
GO:0004629 Function phospholipase C activity
GO:0005515 Function protein binding
GO:0008270 Function zinc ion binding
GO:0007242 Process intracellular signaling cascade
GO:0006629 Process lipid metabolic process
GO:0015031 Process protein transport
GO:0032312 Process regulation of ARF GTPase activity

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_014716  UCSC Browser NP_055531

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000158762 MI0003137 hsa-miR-193b* CGGGGUUUUGAGGGCGAGAUGA
ENST00000158762 MI0001445 hsa-miR-423-5p UGAGGGGCAGAGAGCGAGACUUU
ENST00000158762 MI0003665 hsa-miR-650 AGGAGGCAGCGCUCUCAGGAC
ENST00000158762 MI0003672 hsa-miR-663 AGGCGGGGCGCCGCGGGACCGC
ENST00000158762 MI0005762 hsa-miR-940 AAGGCAGGGCCCCCGCUCCCC
ENST00000158762 MI0004684 mmu-miR-700 CACGCGGGAACCGAGUCCACC
ENST00000158762 MI0004693 mmu-miR-709 GGAGGCAGAGGCAGGAGGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Cuthbert EJ, et al. (2008) "Substrate specificities and activities of AZAP family Arf GAPs in vivo." Am J Physiol Cell Physiol. 294(1):C263-C270. PMID:18003747
  2. [ + ] Li J, et al. (2007) "An ACAP1-containing clathrin coat complex for endocytic recycling." J Cell Biol. 178(3):453-464. PMID:17664335
  3. [ + ] Wu C, et al. (2007) "Systematic identification of SH3 domain-mediated human protein-protein interactions by peptide array target screening." Proteomics. 7(11):1775-1785. PMID:17474147
  4. [ + ] Zhan X, et al. (2006) "Nitroproteins from a human pituitary adenoma tissue discovered with a nitrotyrosine affinity column and tandem mass spectrometry." Anal Biochem. 354(2):279-289. PMID:16777052
  5. [ + ] Shinozaki-Narikawa N, et al. (2006) "Cooperation of phosphoinositides and BAR domain proteins in endosomal tubulation." Traffic. 7(11):1539-1550. PMID:17010122
  6. [ + ] Yamamoto-Furusho JK, et al. (2006) "Centaurin beta1 down-regulates nucleotide-binding oligomerization domains 1- and 2-dependent NF-kappaB activation." J Biol Chem. 281(47):36060-36070. PMID:17005562
  7. [ + ] Rual JF, et al. (2005) "Towards a proteome-scale map of the human protein-protein interaction network." Nature. 437(7062):1173-1178. PMID:16189514
  8. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  9. [ + ] Dai J, et al. (2004) "ACAP1 promotes endocytic recycling by recognizing recycling sorting signals." Dev Cell. 7(5):771-776. PMID:15525538
  10. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  11. [ + ] Jackson TR, et al. (2000) "ACAPs are arf6 GTPase-activating proteins that function in the cell periphery." J Cell Biol. 151(3):627-638. PMID:11062263
  12. [ + ] Jackson TR, et al. (2000) "Cytohesins and centaurins: mediators of PI 3-kinase-regulated Arf signaling." Trends Biochem Sci. 25(10):489-495. PMID:11050434
  13. [ + ] Adams MD, et al. (1995) "Initial assessment of human gene diversity and expression patterns based upon 83 million nucleotides of cDNA sequence." Nature. 377(6547 Suppl):3-174. PMID:7566098
  14. [ + ] Nomura N, et al. (1994) "Prediction of the coding sequences of unidentified human genes. II. The coding sequences of 40 new genes (KIAA0041-KIAA0080) deduced by analysis of cDNA clones from human cell line KG-1." DNA Res. 1(5):223-229. PMID:7584044