AATK | GeneID:9625 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 9625 Official Symbol AATK
Locus N/A Gene Type protein-coding
Synonyms AATYK; AATYK1; KIAA0641; LMR1; LMTK1; p35BP
Full Name apoptosis-associated tyrosine kinase
Description apoptosis-associated tyrosine kinase
Chromosome 17q25.3
Also Known As CDK5-binding protein; lemur tyrosine kinase 1; p35-binding protein; serine/threonine-protein kinase LMTK1
Summary The protein encoded by this gene contains a tyrosine kinase domain at the N-terminus and a proline-rich domain at the C-terminus. This gene is induced during apoptosis, and expression of this gene may be a necessary pre-requisite for the induction of growth arrest and/or apoptosis of myeloid precursor cells. This gene has been shown to produce neuronal differentiation in a neuroblastoma cell line. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 74861

ID Symbol Protein Species
GeneID:9625 AATK NP_001073864.1 Homo sapiens
GeneID:11302 Aatk NP_031403.2 Mus musculus
GeneID:511515 AATK XP_588863.3 Bos taurus
GeneID:555739 LOC555739 XP_683424.3 Danio rerio
GeneID:690853 Aatk XP_001075880.1 Rattus norvegicus
GeneID:100004850 LOC100004850 XP_001344052.2 Danio rerio
GeneID:100149793 LOC100149793 XP_001920174.1 Danio rerio

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab60156 AATK antibody - Carboxyterminal end (ab60156); Rabbit polyclonal to AATK - Carboxyterminal end
2 abcam ab56625 AATK antibody (ab56625); Mouse monoclonal to AATK
3 abgent AP7100d AATK Antibody (Center); Purified Rabbit Polyclonal Antibody (Pab)
4 abgent AP7100b AATK Antibody (C-term); Purified Rabbit Polyclonal Antibody (Pab)
5 abnova H00009625-M03A AATK monoclonal antibody (M03), clone 5B8; Mouse monoclonal antibody raised against a partial recombinant AATK.
6 abnova H00009625-M04 AATK monoclonal antibody (M04), clone 2C8; Mouse monoclonal antibody raised against a partial recombinant AATK.
7 abnova H00009625-M04A AATK monoclonal antibody (M04), clone 2C8; Mouse monoclonal antibody raised against a partial recombinant AATK.
8 abnova H00009625-M01 AATK monoclonal antibody (M01), clone 5H5; Mouse monoclonal antibody raised against a partial recombinant AATK.
9 abnova H00009625-M02 AATK monoclonal antibody (M02), clone 2D10; Mouse monoclonal antibody raised against a partial recombinant AATK.
10 abnova H00009625-M03 AATK monoclonal antibody (M03), clone 5B8; Mouse monoclonal antibody raised against a partial recombinant AATK.
11 acris AP13703PU-N LMTK1 / AATK (C-term); antibody Ab
12 acris AP13705PU-N LMTK1 / AATK (Center); antibody Ab
13 scbt AATK AATK Antibody / AATK Antibodies;
14 sigma HPA009073 Anti-AATK antibody produced in rabbit ;

Exon, Intron and UTRs

Exon, Intron and UTRs of AATK Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of AATK Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0005739 Component mitochondrion
GO:0048471 Component perinuclear region of cytoplasm
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding
GO:0005515 Function protein binding
GO:0004674 Function protein serine/threonine kinase activity
GO:0004713 Function protein tyrosine kinase activity
GO:0016740 Function transferase activity
GO:0006468 Process protein amino acid phosphorylation

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001080395  UCSC Browser NP_001073864

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000326724 MI0000433 hsa-let-7g* CUGUACAGGCCACUGCCUUGC
ENST00000326724 MI0000272 hsa-miR-182 UUUGGCAAUGGUAGAACUCACACU
ENST00000326724 MI0000279 hsa-miR-196a* CGGCAACAAGAAACUGCCUGAG
ENST00000326724 MI0000295 hsa-miR-218-2* CAUGGUUCUGUCAAGCACCGCG
ENST00000326724 MI0000082 hsa-miR-25 CAUUGCACUUGUCUCGGUCUGA
ENST00000326724 MI0005775 hsa-miR-297 AUGUAUGUGUGCAUGUGCAUG
ENST00000326724 MI0002470 hsa-miR-486-3p CGGGGCAGCUCAGUACAGGAU
ENST00000326724 MI0002470 hsa-miR-486-5p UCCUGUACUGAGCUGCCCCGAG
ENST00000326724 MI0003188 hsa-miR-503 UAGCAGCGGGAACAGUUCUGCAG
ENST00000326724 MI0003581 hsa-miR-574-5p UGAGUGUGUGUGUGUGAGUGUGU
ENST00000326724 MI0003597 hsa-miR-588 UUGGCCACAAUGGGUUAGAAC
ENST00000326724 MI0003608 hsa-miR-596 AAGCCUGCCCGGCUCCUCGGG
ENST00000326724 MI0003614 hsa-miR-601 UGGUCUAGGAUUGUUGGAGGAG
ENST00000326724 MI0003615 hsa-miR-602 GACACGGGCGACAGCUGCGGCCC
ENST00000326724 MI0003635 hsa-miR-621 GGCUAGCAACAGCGCUUACCU
ENST00000326724 MI0003654 hsa-miR-639 AUCGCUGCGGUUGCGAGCGCUGU
ENST00000326724 MI0005559 hsa-miR-744 UGCGGGGCUAGGGCUAACAGCA
ENST00000326724 MI0005532 hsa-miR-874 CUGCCCUGGCCCGAGGGACCGA
ENST00000326724 MI0005538 hsa-miR-892b CACUGGCUCCUUUCUGGGUAGA
ENST00000326724 MI0003560 hsa-miR-92b UAUUGCACUCGUCCCGGCCUCC
ENST00000326724 MI0005493 mmu-miR-327 ACUUGAGGGGCAUGAGGAU
ENST00000326724 MI0002401 mmu-miR-466a-5p UAUGUGUGUGUACAUGUACAUA
ENST00000326724 MI0005502 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENST00000326724 MI0005503 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENST00000326724 MI0005504 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENST00000326724 MI0005505 mmu-miR-466c-5p GAUGUGUGUGUGCAUGUACAUA
ENST00000326724 MI0005546 mmu-miR-466d-5p UGUGUGUGCGUACAUGUACAUG
ENST00000326724 MI0005506 mmu-miR-466e-5p GAUGUGUGUGUACAUGUACAUA
ENST00000326724 MI0005510 mmu-miR-466g AUACAGACACAUGCACACACA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

[ - ] Somatic Mutations in Cancer - Sanger's COSMIC

The mutation data was obtained from the Sanger Institute Catalogue Of Somatic Mutations In Cancer web site, http://www.sanger.ac.uk/cosmic Bamford et al (2004) The COSMIC (Catalogue of Somatic Mutations in Cancer) database and website. Br J Cancer, 91,355-358.
Mutation (top 10)Total Observations
c.289C>G1
c.242C>T1
c.2367T>G1
c.660G>A1
c.310A>G1
Primary Site / Histology (Top 10)Mutations (sites * observations)
ovary / carcinoma2
lung / carcinoma1
stomach / carcinoma1
upper aerodigestive tract / carcinoma1

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Acetaminophen
  • Acetaminophen affects the expression of AATK mRNA
17562736
Carbon Tetrachloride
  • Carbon Tetrachloride results in decreased expression of AATK mRNA
17484886
Ethinyl Estradiol
  • Ethinyl Estradiol results in decreased expression of AATK mRNA
15576828
Raloxifene
  • Raloxifene results in increased expression of AATK mRNA
15576828

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Albuminuria inferred via Raloxifene 17308373, 17451421
Alzheimer Disease inferred via Raloxifene 15800139
Brain Injuries inferred via Raloxifene 16580743
Breast Neoplasms inferred via Raloxifene 17242785, 15572757, 15758505, 17261762, 17049068, 17952589, 17893378, 16912660, 15775269, 17440819, 16837676, 17595753
Carcinoma, Transitional Cell inferred via Raloxifene 17572228
Cardiovascular Diseases inferred via Raloxifene 15775269
Cognition Disorders inferred via Raloxifene 15800139
Depressive Disorder, Major inferred via Raloxifene 17474826
Diabetic Nephropathies inferred via Raloxifene 17308373, 17451421, 15920148
Edema inferred via Raloxifene 15860553
Encephalomyelitis, Autoimmune, Experimental inferred via Raloxifene 15845917
Fatty Liver inferred via Raloxifene 17473493
Heart Diseases inferred via Raloxifene 11110106
Hypertension inferred via Raloxifene 15787275, 17577099
Leiomyoma inferred via Raloxifene 16973256
Mixed Tumor, Mullerian inferred via Raloxifene 15863610
Multiple Myeloma inferred via Raloxifene 16497877
Myxoma inferred via Raloxifene 16343187
Osteoporosis inferred via Raloxifene 15775268, 17882678
Osteoporosis, Postmenopausal inferred via Raloxifene 15758505, 17893378, 17823083, 15579764
Prostatic Neoplasms inferred via Raloxifene 16220300, 15731164, 16536755
Purpura inferred via Raloxifene 15770314
Stroke inferred via Raloxifene 16837676
Urinary Bladder Neoplasms inferred via Raloxifene 17572228
Venous Thromboembolism inferred via Raloxifene 16837676
Vulvar Neoplasms inferred via Raloxifene 16343187
Acne Vulgaris inferred via Ethinyl Estradiol 17505938
Adenocarcinoma inferred via Ethinyl Estradiol 14692618
Arteriosclerosis inferred via Ethinyl Estradiol 11256880
Arthritis, Experimental inferred via Ethinyl Estradiol 15885639
Cholestasis inferred via Ethinyl Estradiol 17110522, 17333356, 17681005, 16919318, 16105132, 11677210, 15861022
Encephalomyelitis, Autoimmune, Experimental inferred via Ethinyl Estradiol 12538720
Fatty Liver inferred via Ethinyl Estradiol 15345470
Hypospadias inferred via Ethinyl Estradiol 16569931, 16945680
Infertility, Female inferred via Ethinyl Estradiol 12013081
Infertility, Male inferred via Ethinyl Estradiol 17937319
Panic Disorder inferred via Ethinyl Estradiol 11578682
Pruritus inferred via Ethinyl Estradiol 16919318, 15861022
Spermatocele inferred via Ethinyl Estradiol 16709447
Thrombophilia inferred via Ethinyl Estradiol 11994571
Thrombosis inferred via Ethinyl Estradiol 15669648
Uterine Neoplasms inferred via Ethinyl Estradiol 14692618
Venous Thrombosis inferred via Ethinyl Estradiol 15869587
Carbon Tetrachloride Poisoning inferred via Carbon Tetrachloride 16192424, 15700767, 16124888, 16227642, 10355542, 16050911, 15673190, 16011737, 16097048
Fatty Liver inferred via Carbon Tetrachloride 16045604, 61145, 12631006, 15959796, 16239168, 12795759, 17595544
Hepatitis, Toxic inferred via Carbon Tetrachloride 17522070, 11566570, 16227642, 15998439, 16177239, 15968718, 15027814
Hyperbilirubinemia inferred via Carbon Tetrachloride 16899240
Liver Cirrhosis inferred via Carbon Tetrachloride 17174718, 16221502, 16239168, 17334410, 16943688
Liver Cirrhosis, Experimental inferred via Carbon Tetrachloride 16192424, 16248980, 15925388, 16116963, 17525996, 17557913, 18156304, 16011737, 18251166, 17823541, 17944888, 18395914, 18279442, 16027843, 15996030, 16033810, 17565644, 17869086, 17708605, 12667390, 14748882, 13678700, 15818738, 17631135, 16097048, 15673190, 12649538, 17721639, 18277467, 18205269, 14716496, 15730626, 12632514, 15052691, 12632512, 17766677, 18418968, 12666154, 16638106, 18395095, 18376398, 12389079, 18187930, 18210741, 16015684, 12741479, 14724832, 18472094, 15931870, 17698563, 15893842, 12958196, 17640975, 18412020, 17714472, 14512876, 12609069, 18166357, 17922224, 18420326, 15876570, 12445421, 12445418, 15959796, 12898905, 18317297, 17761835, 14620537, 18472332, 14716833, 16136751, 17481882, 17900296, 15123356, 18339082, 18429990, 12546737, 18006644, 18481824, 15057751, 12586293, 18054572, 10355542, 17976157, 17805973
Liver Diseases inferred via Carbon Tetrachloride 16246199, 16964402, 17285989, 15830285, 15720792
Liver Failure inferred via Carbon Tetrachloride 15123358
Liver Failure, Acute inferred via Carbon Tetrachloride 14706259, 16899240
Liver Neoplasms, Experimental inferred via Carbon Tetrachloride 15583823
Hepatitis, Toxic inferred via Acetaminophen 2444490, 16177239, 15968718, 16227642, 14986274, 16081117, 17562736, 17522070
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
STK39 STK39 / AATK Two-hybrid Piechotta K (2003)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Barbe L, et al. (2008) "Toward a confocal subcellular atlas of the human proteome." Mol Cell Proteomics. 7(3):499-508. PMID:18029348
  2. [ + ] Tomomura M, et al. (2007) "Structural and functional analysis of the apoptosis-associated tyrosine kinase (AATYK) family." Neuroscience. 148(2):510-521. PMID:17651901
  3. [ + ] Lee S, et al. (2006) "Differential expression in normal-adenoma-carcinoma sequence suggests complex molecular carcinogenesis in colon." Oncol Rep. 16(4):747-754. PMID:16969489
  4. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  5. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  6. [ + ] Tomomura M, et al. (2003) "Differential expression and function of apoptosis-associated tyrosine kinase (AATYK) in the developing mouse brain." Brain Res Mol Brain Res. 112(1-2):103-112. PMID:12670708
  7. [ + ] Honma N, et al. (2003) "Apoptosis-associated tyrosine kinase is a Cdk5 activator p35 binding protein." Biochem Biophys Res Commun. 310(2):398-404. PMID:14521924
  8. [ + ] Piechotta K, et al. (2003) "Characterization of the interaction of the stress kinase SPAK with the Na+-K+-2Cl- cotransporter in the nervous system: evidence for a scaffolding role of the kinase." J Biol Chem. 278(52):52848-52856. PMID:14563843
  9. [ + ] Nakajima D, et al. (2002) "Construction of expression-ready cDNA clones for KIAA genes: manual curation of 330 KIAA cDNA clones." DNA Res. 9(3):99-106. PMID:12168954
  10. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  11. [ + ] Tomomura M, et al. (2001) "Characterization of the apoptosis-associated tyrosine kinase (AATYK) expressed in the CNS." Oncogene. 20(9):1022-1032. PMID:11314040
  12. [ + ] Baker SJ, et al. (2001) "Characterization of an alternatively spliced AATYK mRNA: expression pattern of AATYK in the brain and neuronal cells." Oncogene. 20(9):1015-1021. PMID:11314039
  13. [ + ] Raghunath M, et al. (2000) "A novel kinase, AATYK induces and promotes neuronal differentiation in a human neuroblastoma (SH-SY5Y) cell line." Brain Res Mol Brain Res. 77(2):151-162. PMID:10837911
  14. [ + ] Seki N, et al. (1999) "Chromosomal assignment of a human apoptosis-associated tyrosine kinase gene on chromosome 17q25.3 by somatic hybrid analysis and fluorescence in situ hybridization." J Hum Genet. 44(2):141-142. PMID:10083745
  15. [ + ] Ishikawa K, et al. (1998) "Prediction of the coding sequences of unidentified human genes. X. The complete sequences of 100 new cDNA clones from brain which can code for large proteins in vitro." DNA Res. 5(3):169-176. PMID:9734811