ABCG1 | GeneID:9619 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 9619 Official Symbol ABCG1
Locus N/A Gene Type protein-coding
Synonyms ABC8; MGC34313; WHITE1
Full Name ATP-binding cassette, sub-family G (WHITE), member 1
Description ATP-binding cassette, sub-family G (WHITE), member 1
Chromosome 21q22.3
Also Known As ABC transporter 8; ATP-binding cassette sub-family G member 1; ATP-binding cassette transporter 8; ATP-binding cassette transporter member 1 of subfamily G; OTTHUMP00000109322; homolog of Drosophila white; white protein homolog (ATP-binding cassette transporter 8)
Summary The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the White subfamily. It is involved in macrophage cholesterol and phospholipids transport, and may regulate cellular lipid homeostasis in other cell types. Six alternative splice variants have been identified. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 21022

ID Symbol Protein Species
GeneID:9619 ABCG1 NP_004906.3 Homo sapiens
GeneID:11307 Abcg1 NP_033723.1 Mus musculus
GeneID:33636 Atet NP_001097078.1 Drosophila melanogaster
GeneID:85264 Abcg1 NP_445954.1 Rattus norvegicus
GeneID:178182 wht-5 NP_502352.1 Caenorhabditis elegans
GeneID:190068 wht-9 NP_499616.1 Caenorhabditis elegans
GeneID:418533 ABCG1 XP_416742.2 Gallus gallus
GeneID:458577 ABCG1 XP_514918.2 Pan troglodytes
GeneID:487777 ABCG1 XP_544902.2 Canis lupus familiaris
GeneID:510745 ABCG1 XP_587930.3 Bos taurus
GeneID:556979 zgc:162197 NP_001103924.1 Danio rerio
GeneID:840064 AT1G31770 NP_564383.1 Arabidopsis thaliana
GeneID:1281268 AgaP_AGAP001858 XP_550960.1 Anopheles gambiae
GeneID:4344750 Os08g0167000 NP_001061077.1 Oryza sativa

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab52617 ABCG1 antibody [EP1366Y] (ab52617); Rabbit monoclonal [EP1366Y] to ABCG1
2 abcam ab36969 ABCG1 antibody (ab36969); Rabbit polyclonal to ABCG1
3 abnova H00009619-M03 ABCG1 monoclonal antibody (M03), clone 2H8; Mouse monoclonal antibody raised against a partial recombinant ABCG1.
4 abnova H00009619-M01 ABCG1 monoclonal antibody (M01), clone 2E11; Mouse monoclonal antibody raised against a partial recombinant ABCG1.
5 acris AP17071PU-N ABCG1 (Center); antibody Ab
6 acris AP17072PU-N ABCG1 (N-term); antibody Ab
7 scbt ABCG1 ABCG1 Antibody / ABCG1 Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of ABCG1 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ABCG1 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005783 Component endoplasmic reticulum
GO:0005789 Component endoplasmic reticulum membrane
GO:0005768 Component endosome
GO:0005794 Component Golgi apparatus
GO:0000139 Component Golgi membrane
GO:0005887 Component integral to plasma membrane
GO:0005886 Component plasma membrane
GO:0043531 Function ADP binding
GO:0016887 Function ATPase activity
GO:0005524 Function ATP binding
GO:0015485 Function cholesterol binding
GO:0017127 Function cholesterol transporter activity
GO:0034437 Function glycoprotein transporter activity
GO:0000166 Function nucleotide binding
GO:0005543 Function phospholipid binding
GO:0005548 Function phospholipid transporter activity
GO:0046982 Function protein heterodimerization activity
GO:0042803 Function protein homodimerization activity
GO:0034041 Function sterol-transporting ATPase activity
GO:0019534 Function toxin transporter activity
GO:0042987 Process amyloid precursor protein catabolic process
GO:0033344 Process cholesterol efflux
GO:0042632 Process cholesterol homeostasis
GO:0008203 Process cholesterol metabolic process
GO:0009720 Process detection of hormone stimulus
GO:0010742 Process foam cell differentiation
GO:0034436 Process glycoprotein transport
GO:0032367 Process intracellular cholesterol transport
GO:0006869 Process lipid transport
GO:0033700 Process phospholipid efflux
GO:0055091 Process phospholipid homeostasis
GO:0045542 Process positive regulation of cholesterol biosynthetic process
GO:0010884 Process positive regulation of lipid storage
GO:0045449 Process regulation of transcription
GO:0010033 Process response to organic substance
GO:0043691 Process reverse cholesterol transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_004915  UCSC Browser NP_004906
2 NM_016818  UCSC Browser NP_058198
3 NM_207174  UCSC Browser NP_997057
4 NM_207627  UCSC Browser NP_997510
5 NM_207628  UCSC Browser NP_997511
6 NM_207629  UCSC Browser NP_997512

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000347800 MI0000102 hsa-miR-100 AACCCGUAGAUCCGAACUUGUG
ENST00000347800 MI0000457 hsa-miR-141* CAUCUUCCAGUACAGUGUUGGA
ENST00000347800 MI0000272 hsa-miR-182* UGGUUCUAGACUUGCCAACUA
ENST00000347800 MI0000242 hsa-miR-199a-5p CCCAGUGUUCAGACUACCUGUUC
ENST00000347800 MI0000281 hsa-miR-199a-5p CCCAGUGUUCAGACUACCUGUUC
ENST00000347800 MI0000282 hsa-miR-199b-5p CCCAGUGUUUAGACUAUCUGUUC
ENST00000347800 MI0000772 hsa-miR-302b UAAGUGCUUCCAUGUUUUAGUAG
ENST00000347800 MI0000773 hsa-miR-302c UAAGUGCUUCCAUGUUUCAGUGG
ENST00000347800 MI0000774 hsa-miR-302d UAAGUGCUUCCAUGUUUGAGUGU
ENST00000347800 MI0000762 hsa-miR-362-3p AACACACCUAUUCAAGGAUUCA
ENST00000347800 MI0000791 hsa-miR-383 AGAUCAGAAGGUGAUUGUGGCU
ENST00000347800 MI0001444 hsa-miR-422a ACUGGACUUAGGGUCAGAAGGC
ENST00000347800 MI0003513 hsa-miR-455-5p UAUGUGCCUUUGGACUACAUCG
ENST00000347800 MI0003140 hsa-miR-512-3p AAGUGCUGUCAUAGCUGAGGUC
ENST00000347800 MI0003141 hsa-miR-512-3p AAGUGCUGUCAUAGCUGAGGUC
ENST00000347800 MI0003625 hsa-miR-612 GCUGGGCAGGGCUUCUGAGCUCCUU
ENST00000347800 MI0000466 hsa-miR-9* AUAAAGCUAGAUAACCGAAAGU
ENST00000347800 MI0000467 hsa-miR-9* AUAAAGCUAGAUAACCGAAAGU
ENST00000347800 MI0000468 hsa-miR-9* AUAAAGCUAGAUAACCGAAAGU
ENST00000347800 MI0005759 hsa-miR-937 AUCCGCGCUCUGACUCUCUGCC
ENST00000347800 MI0005768 hsa-miR-943 CUGACUGUUGCCGUCCUCCAG
ENST00000347800 MI0000101 hsa-miR-99a AACCCGUAGAUCCGAUCUUGUG
ENST00000347800 MI0000746 hsa-miR-99b CACCCGUAGAACCGACCUUGCG
ENST00000347800 MI0001526 mmu-miR-434-5p GCUCGACUCAUGGUUUGAACCA
ENST00000347800 MI0004196 mmu-miR-667 UGACACCUGCCACCCAGCCCAAG
ENST00000347800 MI0004696 mmu-miR-712 CUCCUUCACCCGGGCGGUACC
ENST00000347800 MI0004516 mmu-miR-763 CCAGCUGGGAAGAACCAGUGGC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
22-hydroxycholesterol
  • 22-hydroxycholesterol results in increased expression of ABCG1 mRNA
16730733
Acetaminophen
  • Acetaminophen affects the expression of ABCG1 mRNA
17562736
Acetylcysteine
  • Acetylcysteine results in decreased expression of ABCG1 mRNA
16084531
alitretinoin
  • [T 0901317 co-treated with alitretinoin] results in increased expression of ABCG1 mRNA
  • [T 0901317 co-treated with alitretinoin] results in increased expression of ABCG1 mRNA
  • alitretinoin results in increased expression of ABCG1 mRNA
16024918
alitretinoin
  • alitretinoin results in increased expression of ABCG1 mRNA
16730733
Arachidonic Acid
  • Arachidonic Acid results in decreased expression of ABCG1 mRNA
16730733
Carbon Tetrachloride
  • Carbon Tetrachloride results in increased expression of ABCG1 protein
17544377
Cholesterol
  • Cholesterol results in increased expression of ABCG1 mRNA
15342687
Cholesterol
  • ABCG1 protein affects the export of Cholesterol
16024918
Clofibric Acid
  • [Diethylnitrosamine co-treated with Clofibric Acid] affects the expression of ABCG1 mRNA
17602206
Diethylnitrosamine
  • [Diethylnitrosamine co-treated with Clofibric Acid] affects the expression of ABCG1 mRNA
17602206
Eicosapentaenoic Acid
  • Eicosapentaenoic Acid results in decreased expression of ABCG1 mRNA
  • Eicosapentaenoic Acid results in decreased expression of ABCG1 protein
16730733
epigallocatechin gallate
  • epigallocatechin gallate results in decreased expression of ABCG1 mRNA
16084531
Ethinyl Estradiol
  • Ethinyl Estradiol results in increased expression of ABCG1 mRNA
17557909, 17351261
GW 3965
  • GW 3965 results in increased expression of ABCG1 mRNA
15633131
GW 3965
  • GW 3965 results in increased expression of ABCG1 mRNA
17449538
Linoleic Acid
  • Linoleic Acid results in decreased expression of ABCG1 mRNA
  • Linoleic Acid results in decreased expression of ABCG1 protein
16730733
Lipopolysaccharides
  • Lipopolysaccharides results in decreased expression of ABCG1 mRNA
  • Lipopolysaccharides results in increased expression of ABCG1 mRNA
12057914
Mercury
  • Mercury results in increased expression of ABCG1 mRNA
16823088
nitrosobenzylmethylamine
  • nitrosobenzylmethylamine results in increased expression of ABCG1 mRNA
17616710
Oleic Acid
  • Oleic Acid results in decreased expression of ABCG1 mRNA
  • Oleic Acid results in decreased expression of ABCG1 protein
16730733
Palmitic Acid
  • Palmitic Acid results in increased expression of ABCG1 mRNA
16730733
perfluorooctanoic acid
  • perfluorooctanoic acid results in increased expression of ABCG1 mRNA
16221955
Phenytoin
  • Phenytoin results in decreased expression of ABCG1 mRNA
15136057
Phthalic Acids
  • Phthalic Acids results in increased expression of ABCG1 mRNA
15728792
polyphenols
  • polyphenols results in decreased expression of ABCG1 mRNA
16293270
Progesterone
  • Progesterone results in increased expression of ABCG1 mRNA
18070364
Raloxifene
  • Raloxifene affects the expression of ABCG1 mRNA
14699072
resveratrol
  • resveratrol results in increased expression of ABCG1 mRNA
16901463
Rifampin
  • Rifampin results in increased expression of ABCG1 mRNA
12040753
stearic acid
  • stearic acid results in increased expression of ABCG1 mRNA
16730733
T 0901317
  • T 0901317 results in increased expression of ABCG1 mRNA
17449538, 16024918
T 0901317
  • [T 0901317 co-treated with alitretinoin] results in increased expression of ABCG1 mRNA
  • T 0901317 results in increased expression of ABCG1 mRNA
  • [T 0901317 co-treated with alitretinoin] results in increased expression of ABCG1 mRNA
16024918
Zinc
  • Zinc results in increased expression of ABCG1 mRNA
17074742
Zinc Sulfate
  • Zinc Sulfate results in increased expression of ABCG1 mRNA
17074742

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Hepatolenticular Degeneration inferred via Zinc Sulfate 17063115
Acrodermatitis inferred via Zinc 17190629, 17202136, 16889938
Alzheimer Disease inferred via Zinc 17119284, 16580781, 16325427, 16410023
Anemia, Sickle Cell inferred via Zinc 16916123
Asthma inferred via Zinc 17085522
Brain Injuries inferred via Zinc 17109824
Carcinoma, Squamous Cell inferred via Zinc 16543248
Cardiovascular Diseases inferred via Zinc 16936243
Diabetes Mellitus inferred via Zinc 16479319
Esophageal Neoplasms inferred via Zinc 16543248
Gastritis inferred via Zinc 17241300
Growth Disorders inferred via Zinc 17217573
Heart Failure inferred via Zinc 17162251
Heart Injuries inferred via Zinc 17074742
Helicobacter Infections inferred via Zinc 17241300
Hepatolenticular Degeneration inferred via Zinc 17276780
Ischemia inferred via Zinc 16584753
Kidney Diseases inferred via Zinc 16960431
Kidney Failure, Chronic inferred via Zinc 16518626
Mammary Neoplasms, Experimental inferred via Zinc 12773700
Pre-Eclampsia inferred via Zinc 17114810
Prostatic Neoplasms inferred via Zinc 12429649, 16517595, 16606632, 16700911
Retinal Degeneration inferred via Zinc 16584753
Tongue Neoplasms inferred via Zinc 16543248
Mycobacterium Infections inferred via Rifampin 18474467
Tuberculosis inferred via Rifampin 18397238, 15236969
Adenoma inferred via resveratrol 15688382
Alzheimer Disease inferred via resveratrol 16183991, 16162502
Arthritis, Experimental inferred via resveratrol 17115116
Atherosclerosis inferred via resveratrol 16873680, 17967414
Brain Ischemia inferred via resveratrol 17600658
Breast Neoplasms inferred via resveratrol 17651959, 16393696, 17534123
Carcinoma, Hepatocellular inferred via resveratrol 16227395
Carcinoma, Lewis Lung inferred via resveratrol 16675471
Carcinoma, Squamous Cell inferred via resveratrol 16227395
Cardiovascular Diseases inferred via resveratrol 15458977
Colitis inferred via resveratrol 16474422
Colonic Neoplasms inferred via resveratrol 16338953
Colorectal Neoplasms inferred via resveratrol 16550006
Diabetes Mellitus, Experimental inferred via resveratrol 16873680
Diabetic Nephropathies inferred via resveratrol 16286809
Edema inferred via resveratrol 8985016
Encephalomyelitis, Autoimmune, Experimental inferred via resveratrol 17872969
Enterocolitis, Necrotizing inferred via resveratrol 17923197
Herpes Simplex inferred via resveratrol 16876885
Hypercholesterolemia inferred via resveratrol 17188708
Hyperlipidemias inferred via resveratrol 16873680
Hypertrophy, Left Ventricular inferred via resveratrol 17488730
Infarction, Middle Cerebral Artery inferred via resveratrol 17600658
Inflammation inferred via resveratrol 16366677
Influenza, Human inferred via resveratrol 16624496
Kidney Failure, Acute inferred via resveratrol 16538975
Leukemia, Promyelocytic, Acute inferred via resveratrol 16087638
Lymphoma, B-Cell inferred via resveratrol 17088997
Lymphoma, Non-Hodgkin inferred via resveratrol 14749477
Mammary Neoplasms, Animal inferred via resveratrol 15688416
Mammary Neoplasms, Experimental inferred via resveratrol 8985016, 11606380
Melanoma inferred via resveratrol 17992120
Metabolic Diseases inferred via resveratrol 17112576
Multiple Myeloma inferred via resveratrol 14749477, 17935668, 17049120, 16267019, 16490592, 17164350
Muscular Atrophy, Spinal inferred via resveratrol 17962980
Myocardial Infarction inferred via resveratrol 17188708, 16525036, 16456233, 16317513, 17015251, 17125593
Myocardial Ischemia inferred via resveratrol 17125593, 17015251
Myocarditis inferred via resveratrol 17322642
Neoplasms, Experimental inferred via resveratrol 8985016
Neurodegenerative Diseases inferred via resveratrol 17652729
Neurogenic Inflammation inferred via resveratrol 17929310
Osteoporosis, Postmenopausal inferred via resveratrol 17513867
Prenatal Exposure Delayed Effects inferred via resveratrol 16679765
Prostatic Neoplasms inferred via resveratrol 17675339, 17718901, 15767336, 16731767, 17804756, 17636462
Renal Insufficiency, Chronic inferred via resveratrol 16325855
Reperfusion Injury inferred via resveratrol 17058453, 16314181, 16317513, 15827377, 17520802
Skin Neoplasms inferred via resveratrol 15837718, 8985016
STROKE, ISCHEMIC inferred via resveratrol 16321402
Tongue Neoplasms inferred via resveratrol 16227395
Uterine Cervical Neoplasms inferred via resveratrol 17473185
Uterine Neoplasms inferred via resveratrol 17044934
Ventricular Dysfunction, Left inferred via resveratrol 17488730
Albuminuria inferred via Raloxifene 17308373, 17451421
Alzheimer Disease inferred via Raloxifene 15800139
Brain Injuries inferred via Raloxifene 16580743
Breast Neoplasms inferred via Raloxifene 17242785, 16837676, 15775269, 17440819, 16912660, 17893378, 17049068, 15758505, 17952589, 17595753, 17261762, 15572757
Carcinoma, Transitional Cell inferred via Raloxifene 17572228
Cardiovascular Diseases inferred via Raloxifene 15775269
Cognition Disorders inferred via Raloxifene 15800139
Depressive Disorder, Major inferred via Raloxifene 17474826
Diabetic Nephropathies inferred via Raloxifene 17308373, 17451421, 15920148
Edema inferred via Raloxifene 15860553
Encephalomyelitis, Autoimmune, Experimental inferred via Raloxifene 15845917
Fatty Liver inferred via Raloxifene 17473493
Heart Diseases inferred via Raloxifene 11110106
Hypertension inferred via Raloxifene 15787275, 17577099
Leiomyoma inferred via Raloxifene 16973256
Mixed Tumor, Mullerian inferred via Raloxifene 15863610
Multiple Myeloma inferred via Raloxifene 16497877
Myxoma inferred via Raloxifene 16343187
Osteoporosis inferred via Raloxifene 15775268, 17882678
Osteoporosis, Postmenopausal inferred via Raloxifene 15758505, 15579764, 17893378, 17823083
Prostatic Neoplasms inferred via Raloxifene 16220300, 16536755, 15731164
Purpura inferred via Raloxifene 15770314
Stroke inferred via Raloxifene 16837676
Urinary Bladder Neoplasms inferred via Raloxifene 17572228
Venous Thromboembolism inferred via Raloxifene 16837676
Vulvar Neoplasms inferred via Raloxifene 16343187
Brain Hemorrhage, Traumatic inferred via Progesterone 17868700
Brain Injuries inferred via Progesterone 15665606, 15380490, 15845082
Breast Neoplasms inferred via Progesterone 17614352, 15562024, 16175315
Diabetic Neuropathies inferred via Progesterone 17187935
Encephalomyelitis, Autoimmune, Experimental inferred via Progesterone 17692515
Endometriosis inferred via Progesterone 16134523
Mammary Neoplasms, Experimental inferred via Progesterone 17203775, 11408345
Ovarian Neoplasms inferred via Progesterone 17393432, 16525653
Salivary Gland Neoplasms inferred via Progesterone 18045962
Spinal Cord Injuries inferred via Progesterone 15862959, 16503802
Colonic Neoplasms inferred via polyphenols 16293270
Inflammation inferred via polyphenols 16366677
Liver Diseases inferred via polyphenols 16698588
Abnormalities, Drug-Induced inferred via Phenytoin 3425630, 10563481
Atherosclerosis inferred via Phenytoin 15136057
Cleft Palate inferred via Phenytoin 2227380, 1687470, 6856622, 6862529, 10789828, 3877104
Congenital Abnormalities inferred via Phenytoin 10627286
Drug Eruptions inferred via Phenytoin 15024534
Epidermolysis Bullosa inferred via Phenytoin 6251365, 1399206
Epilepsies, Partial inferred via Phenytoin 17116037
Epilepsy inferred via Phenytoin 11434505
Fetal Death inferred via Phenytoin 10627286
Gingival Hyperplasia inferred via Phenytoin 9029455
Gingival Overgrowth inferred via Phenytoin 16390469, 14659971
Hyperhomocysteinemia inferred via Phenytoin 10459572
Liver Diseases inferred via Phenytoin 14986274
Myoclonic Epilepsies, Progressive inferred via Phenytoin 17484760
Myotonia Congenita inferred via Phenytoin 1896199
Osteomalacia inferred via Phenytoin 17016548
Pseudolymphoma inferred via Phenytoin 1419762, 8603615, 12752131
Edema inferred via perfluorooctanoic acid 17259670, 12083418
Hepatomegaly inferred via perfluorooctanoic acid 3609246
Hyperalgesia inferred via perfluorooctanoic acid 12083418
Inflammation inferred via perfluorooctanoic acid 12083418
Leydig Cell Tumor inferred via perfluorooctanoic acid 8812269
Liver Neoplasms inferred via perfluorooctanoic acid 14757943
Niemann-Pick Disease, Type C inferred via perfluorooctanoic acid 9802331
Prenatal Exposure Delayed Effects inferred via perfluorooctanoic acid 17132714
Esophageal Neoplasms inferred via nitrosobenzylmethylamine 16805852, 16704527, 15878914, 15623463, 15150132, 15547721, 15264214, 15547733, 16510608
Stomach Neoplasms inferred via nitrosobenzylmethylamine 17575124, 12958204
Autoimmune Diseases inferred via Mercury 16634805
Hemolytic-Uremic Syndrome inferred via Lipopolysaccharides 16366002
Inflammation inferred via Lipopolysaccharides 17255318, 17963957
Iron Metabolism Disorders inferred via Lipopolysaccharides 17255318
Respiratory Hypersensitivity inferred via Lipopolysaccharides 10835634
Acne Vulgaris inferred via Ethinyl Estradiol 17505938
Adenocarcinoma inferred via Ethinyl Estradiol 14692618
Arteriosclerosis inferred via Ethinyl Estradiol 11256880
Arthritis, Experimental inferred via Ethinyl Estradiol 15885639
Cholestasis inferred via Ethinyl Estradiol 17110522, 17681005, 16105132, 11677210, 15861022, 17333356, 16919318
Encephalomyelitis, Autoimmune, Experimental inferred via Ethinyl Estradiol 12538720
Fatty Liver inferred via Ethinyl Estradiol 15345470
Hypospadias inferred via Ethinyl Estradiol 16569931, 16945680
Infertility, Female inferred via Ethinyl Estradiol 12013081
Infertility, Male inferred via Ethinyl Estradiol 17937319
Panic Disorder inferred via Ethinyl Estradiol 11578682
Pruritus inferred via Ethinyl Estradiol 16919318, 15861022
Spermatocele inferred via Ethinyl Estradiol 16709447
Thrombophilia inferred via Ethinyl Estradiol 11994571
Thrombosis inferred via Ethinyl Estradiol 15669648
Uterine Neoplasms inferred via Ethinyl Estradiol 14692618
Venous Thrombosis inferred via Ethinyl Estradiol 15869587
Asthma inferred via epigallocatechin gallate 16516891
Diabetes Mellitus, Type 2 inferred via epigallocatechin gallate 16988119
Liver Cirrhosis, Experimental inferred via epigallocatechin gallate 17481882
Melanoma inferred via epigallocatechin gallate 17992120, 11746506
Muscular Atrophy, Spinal inferred via epigallocatechin gallate 17962980
Adenoma inferred via Diethylnitrosamine 10737359
Carcinoma, Hepatocellular inferred via Diethylnitrosamine 16878318, 11831363, 10737359, 17428255, 10672840
Liver Neoplasms inferred via Diethylnitrosamine 2422723, 15885732, 12112319, 18648771, 10737359, 16942905
Liver Neoplasms, Experimental inferred via Diethylnitrosamine 16267830, 16842330, 3124819
Liver Neoplasms inferred via Clofibric Acid 17602206
Atherosclerosis inferred via Cholesterol 16632123
Hypercholesterolemia inferred via Cholesterol 16933029
Learning Disorders inferred via Cholesterol 17134702
Niemann-Pick Disease, Type C inferred via Cholesterol 9802331
Carbon Tetrachloride Poisoning inferred via Carbon Tetrachloride 16192424, 15700767, 16124888, 16227642, 10355542, 16050911, 15673190, 16097048, 16011737
Fatty Liver inferred via Carbon Tetrachloride 16045604, 61145, 12631006, 12795759, 17595544, 16239168, 15959796
Hepatitis, Toxic inferred via Carbon Tetrachloride 17522070, 16177239, 11566570, 15027814, 15968718, 16227642, 15998439
Hyperbilirubinemia inferred via Carbon Tetrachloride 16899240
Liver Cirrhosis inferred via Carbon Tetrachloride 17174718, 16943688, 16221502, 16239168, 17334410
Liver Cirrhosis, Experimental inferred via Carbon Tetrachloride 16192424, 16116963, 16248980, 15925388, 17525996, 17766677, 18418968, 12666154, 16638106, 18395095, 18156304, 17976157, 17557913, 17805973, 12649538, 17721639, 18277467, 18205269, 14716496, 15730626, 12632514, 15052691, 12632512, 18006644, 18481824, 15057751, 12586293, 18054572, 10355542, 16011737, 18251166, 17823541, 18412020, 17714472, 14512876, 12609069, 18166357, 17922224, 18420326, 15876570, 18472332, 14716833, 16136751, 17481882, 17900296, 15123356, 18339082, 18429990, 12546737, 17944888, 18395914, 18279442, 16027843, 15996030, 16033810, 17565644, 17869086, 17708605, 12667390, 14748882, 13678700, 15818738, 17631135, 16097048, 15673190, 18376398, 12389079, 18187930, 18210741, 16015684, 12741479, 14724832, 18472094, 15931870, 17698563, 15893842, 12958196, 17640975, 12445421, 12445418, 15959796, 12898905, 18317297, 17761835, 14620537
Liver Diseases inferred via Carbon Tetrachloride 16246199, 17285989, 15830285, 15720792, 16964402
Liver Failure inferred via Carbon Tetrachloride 15123358
Liver Failure, Acute inferred via Carbon Tetrachloride 14706259, 16899240
Liver Neoplasms, Experimental inferred via Carbon Tetrachloride 15583823
Breast Neoplasms inferred via alitretinoin 16344269
Keratosis, Seborrheic inferred via alitretinoin 16144296
Lung Neoplasms inferred via alitretinoin 16413115
Neoplasms inferred via alitretinoin 16946489
Porokeratosis inferred via alitretinoin 16144296
Carcinoma, Squamous Cell inferred via Acetylcysteine 17015178
Hepatitis, Toxic inferred via Acetaminophen 2444490, 17562736, 16081117, 17522070, 14986274, 16177239, 15968718, 16227642
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Jakobsson T, et al. (2009) "GPS2 is required for cholesterol efflux by triggering histone demethylation, LXR recruitment, and coregulator assembly at the ABCG1 locus." Mol Cell. 34(4):510-518. PMID:19481530
  2. [ + ] Saito A, et al. (2009) "Association study between single-nucleotide polymorphisms in 199 drug-related genes and commonly measured quantitative traits of 752 healthy Japanese subjects." J Hum Genet. 54(6):317-323. PMID:19343046
  3. [ + ] Mauerer R, et al. (2009) "High glucose, unsaturated and saturated fatty acids differentially regulate expression of ATP-binding cassette transporters ABCA1 and ABCG1 in human macrophages." Exp Mol Med. 41(2):126-132. PMID:19287193
  4. [ + ] Stefulj J, et al. (2009) "Human endothelial cells of the placental barrier efficiently deliver cholesterol to the fetal circulation via ABCA1 and ABCG1." Circ Res. 104(5):600-608. PMID:19168441
  5. [ + ] Sankaranarayanan S, et al. (2009) "Effects of acceptor composition and mechanism of ABCG1-mediated cellular free cholesterol efflux." J Lipid Res. 50(2):275-284. PMID:18827283
  6. [ + ] Catalano G, et al. (2008) "Cellular SR-BI and ABCA1-mediated cholesterol efflux are gender-specific in healthy subjects." J Lipid Res. 49(3):635-643. PMID:18057374
  7. [ + ] Mauldin JP, et al. (2008) "Reduced expression of ATP-binding cassette transporter G1 increases cholesterol accumulation in macrophages of patients with type 2 diabetes mellitus." Circulation. 117(21):2785-2792. PMID:18490524
  8. [ + ] Lu Y, et al. (2008) "Multiple genetic variants along candidate pathways influence plasma high-density lipoprotein cholesterol concentrations." J Lipid Res. 49(12):2582-2589. PMID:18660489
  9. [ + ] Zhou H, et al. (2008) "Determinants of leukocyte adenosine triphosphate-binding cassette transporter G1 gene expression in type 2 diabetes mellitus." Metabolism. 57(8):1135-1140. PMID:18640393
  10. [ + ] Seres L, et al. (2008) "Functional ABCG1 expression induces apoptosis in macrophages and other cell types." Biochim Biophys Acta. 1778(10):2378-2387. PMID:18619413
  11. [ + ] Burgess B, et al. (2008) "Overexpression of human ABCG1 does not affect atherosclerosis in fat-fed ApoE-deficient mice." Arterioscler Thromb Vasc Biol. 28(10):1731-1737. PMID:18599800
  12. [ + ] Cardinal H, et al. (2007) "Uraemic plasma decreases the expression of ABCA1, ABCG1 and cell-cycle genes in human coronary arterial endothelial cells." Nephrol Dial Transplant. 22(2):409-416. PMID:17082211
  13. [ + ] Uehara Y, et al. (2007) "Unsaturated fatty acids suppress the expression of the ATP-binding cassette transporter G1 (ABCG1) and ABCA1 genes via an LXR/RXR responsive element." Atherosclerosis. 191(1):11-21. PMID:16730733
  14. [ + ] Kim WS, et al. (2007) "Role of ABCG1 and ABCA1 in regulation of neuronal cholesterol efflux to apolipoprotein E discs and suppression of amyloid-beta peptide generation." J Biol Chem. 282(5):2851-2861. PMID:17121837
  15. [ + ] Ecker J, et al. (2007) "Isomer specific effects of Conjugated Linoleic Acid on macrophage ABCG1 transcription by a SREBP-1c dependent mechanism." Biochem Biophys Res Commun. 352(3):805-811. PMID:17141191
  16. [ + ] Gietl A, et al. (2007) "ABCG1 gene variants in suicidal behavior and aggression-related traits." Eur Neuropsychopharmacol. 17(6-7):410-416. PMID:17187964
  17. [ + ] Sporstol M, et al. (2007) "ABCA1, ABCG1 and SR-BI: hormonal regulation in primary rat hepatocytes and human cell lines." BMC Mol Biol. 8():5. PMID:17241464
  18. [ + ] Tansley GH, et al. (2007) "The cholesterol transporter ABCG1 modulates the subcellular distribution and proteolytic processing of beta-amyloid precursor protein." J Lipid Res. 48(5):1022-1034. PMID:17293612
  19. [ + ] Wollmer MA, et al. (2007) "Association study of cholesterol-related genes in Alzheimer's disease." Neurogenetics. 8(3):179-188. PMID:17387528
  20. [ + ] Engel T, et al. (2007) "Expression of ATP binding cassette-transporter ABCG1 prevents cell death by transporting cytotoxic 7beta-hydroxycholesterol." FEBS Lett. 581(8):1673-1680. PMID:17408620
  21. [ + ] Sano O, et al. (2007) "Sphingomyelin-dependence of cholesterol efflux mediated by ABCG1." J Lipid Res. 48(11):2377-2384. PMID:17761632
  22. [ + ] Thomassen MJ, et al. (2007) "ABCG1 is deficient in alveolar macrophages of GM-CSF knockout mice and patients with pulmonary alveolar proteinosis." J Lipid Res. 48(12):2762-2768. PMID:17848583
  23. [ + ] Boadu E, et al. (2006) "Correction of apolipoprotein A-I-mediated lipid efflux and high density lipoprotein particle formation in human Niemann-Pick type C disease fibroblasts." J Biol Chem. 281(48):37081-37090. PMID:17020879
  24. [ + ] Out R, et al. (2006) "Macrophage ABCG1 deletion disrupts lipid homeostasis in alveolar macrophages and moderately influences atherosclerotic lesion development in LDL receptor-deficient mice." Arterioscler Thromb Vasc Biol. 26(10):2295-2300. PMID:16857950
  25. [ + ] Engel T, et al. (2006) "Expression and functional characterization of ABCG1 splice variant ABCG1(666)." FEBS Lett. 580(18):4551-4559. PMID:16870176
  26. [ + ] Vaughan AM, et al. (2006) "ABCA1 and ABCG1 or ABCG4 act sequentially to remove cellular cholesterol and generate cholesterol-rich HDL." J Lipid Res. 47(11):2433-2443. PMID:16902247
  27. [ + ] Gelissen IC, et al. (2006) "ABCA1 and ABCG1 synergize to mediate cholesterol export to apoA-I." Arterioscler Thromb Vasc Biol. 26(3):534-540. PMID:16357317
  28. [ + ] Kobayashi A, et al. (2006) "Efflux of sphingomyelin, cholesterol, and phosphatidylcholine by ABCG1." J Lipid Res. 47(8):1791-1802. PMID:16702602
  29. [ + ] Hu YH, et al. (2006) "Cell array-based intracellular localization screening reveals novel functional features of human chromosome 21 proteins." BMC Genomics. 7():155. PMID:16780588
  30. [ + ] Sabol SL, et al. (2005) "The human ABCG1 gene: identification of LXR response elements that modulate expression in macrophages and liver." J Lipid Res. 46(10):2151-2167. PMID:16024918
  31. [ + ] Kennedy MA, et al. (2005) "ABCG1 has a critical role in mediating cholesterol efflux to HDL and preventing cellular lipid accumulation." Cell Metab. 1(2):121-131. PMID:16054053
  32. [ + ] Vaughan AM, et al. (2005) "ABCG1 redistributes cell cholesterol to domains removable by high density lipoprotein but not by lipid-depleted apolipoproteins." J Biol Chem. 280(34):30150-30157. PMID:15994327
  33. [ + ] Mel'nik ES, et al. (2004) "Analysis of the effect of the Su(Hw) insulator on the expression of the miniwhite gene in Drosophila melanogaster." Dokl Biochem Biophys. 398():282-284. PMID:15584507
  34. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  35. [ + ] Cserepes J, et al. (2004) "Functional expression and characterization of the human ABCG1 and ABCG4 proteins: indications for heterodimerization." Biochem Biophys Res Commun. 320(3):860-867. PMID:15240127
  36. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  37. [ + ] O'Connell BJ, et al. (2004) "Cellular physiology of cholesterol efflux in vascular endothelial cells." Circulation. 110(18):2881-2888. PMID:15492319
  38. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  39. [ + ] Kaplan R, et al. (2002) "Bacterial lipopolysaccharide induces expression of ABCA1 but not ABCG1 via an LXR-independent pathway." J Lipid Res. 43(6):952-959. PMID:12032171
  40. [ + ] Lorkowski S, et al. (2001) "Genomic sequence and structure of the human ABCG1 (ABC8) gene." Biochem Biophys Res Commun. 280(1):121-131. PMID:11162488
  41. [ + ] Lorkowski S, et al. (2001) "Expression of the ATP-binding cassette transporter gene ABCG1 (ABC8) in Tangier disease." Biochem Biophys Res Commun. 283(4):821-830. PMID:11350058
  42. [ + ] Porsch-Ozcurumez M, et al. (2001) "The zinc finger protein 202 (ZNF202) is a transcriptional repressor of ATP binding cassette transporter A1 (ABCA1) and ABCG1 gene expression and a modulator of cellular lipid efflux." J Biol Chem. 276(15):12427-12433. PMID:11279031
  43. [ + ] Schmitz G, et al. (2001) "Role of ABCG1 and other ABCG family members in lipid metabolism." J Lipid Res. 42(10):1513-1520. PMID:11590207
  44. [ + ] Kennedy MA, et al. (2001) "Characterization of the human ABCG1 gene: liver X receptor activates an internal promoter that produces a novel transcript encoding an alternative form of the protein." J Biol Chem. 276(42):39438-39447. PMID:11500512
  45. [ + ] Hattori M, et al. (2000) "The DNA sequence of human chromosome 21." Nature. 405(6784):311-319. PMID:10830953
  46. [ + ] Klucken J, et al. (2000) "ABCG1 (ABC8), the human homolog of the Drosophila white gene, is a regulator of macrophage cholesterol and phospholipid transport." Proc Natl Acad Sci U S A. 97(2):817-822. PMID:10639163
  47. [ + ] Langmann T, et al. (2000) "Genomic organization and characterization of the promoter of the human ATP-binding cassette transporter-G1 (ABCG1) gene." Biochim Biophys Acta. 1494(1-2):175-180. PMID:11072082
  48. [ + ] Berry A, et al. (2000) "Refined localization of autosomal recessive nonsyndromic deafness DFNB10 locus using 34 novel microsatellite markers, genomic structure, and exclusion of six known genes in the region." Genomics. 68(1):22-29. PMID:10950923
  49. [ + ] Venkateswaran A, et al. (2000) "Human white/murine ABC8 mRNA levels are highly induced in lipid-loaded macrophages. A transcriptional role for specific oxysterols." J Biol Chem. 275(19):14700-14707. PMID:10799558
  50. [ + ] Yu W, et al. (1997) "Large-scale concatenation cDNA sequencing." Genome Res. 7(4):353-358. PMID:9110174