ABCG2 | GeneID:9429 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 9429 Official Symbol ABCG2
Locus N/A Gene Type protein-coding
Synonyms ABC15; ABCP; BCRP; BCRP1; BMDP; CD338; CDw338; EST157481; MGC102821; MRX; MXR; MXR1
Full Name ATP-binding cassette, sub-family G (WHITE), member 2
Description ATP-binding cassette, sub-family G (WHITE), member 2
Chromosome 4q22
Also Known As ABC transporter; ATP-binding cassette transporter G2; ATP-binding cassette, sub-family G, member 2; breast cancer resistance protein; mitoxantrone resistance protein; placenta specific MDR protein
Summary The membrane-associated protein encoded by this gene is included in the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the White subfamily. Alternatively referred to as a breast cancer resistance protein, this protein functions as a xenobiotic transporter which may play a major role in multi-drug resistance. It likely serves as a cellular defense mechanism in response to mitoxantrone and anthracycline exposure. Significant expression of this protein has been observed in the placenta, which may suggest a potential role for this molecule in placenta tissue. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 55852

ID Symbol Protein Species
GeneID:9429 ABCG2 NP_004818.2 Homo sapiens
GeneID:26357 Abcg2 NP_036050.1 Mus musculus
GeneID:312382 Abcg2 NP_852046.1 Rattus norvegicus
GeneID:423767 ABCG2 XP_421638.2 Gallus gallus
GeneID:471251 ABCG2 XP_526633.2 Pan troglodytes
GeneID:478472 ABCG2 XP_535650.2 Canis lupus familiaris
GeneID:536203 ABCG2 NP_001032555.2 Bos taurus
GeneID:735310 abcg2d NP_001036237.1 Danio rerio
GeneID:811826 PF14_0244 XP_001348418.1 Plasmodium falciparum
GeneID:830541 AT5G06530 NP_850781.2 Arabidopsis thaliana
GeneID:850369 ADP1 NP_009937.2 Saccharomyces cerevisiae
GeneID:2679509 MGG_01563 XP_363637.2 Magnaporthe grisea
GeneID:2713604 NCU02544.1 XP_331743.1 Neurospora crassa
GeneID:2892892 KLLA0D04554g XP_453265.1 Kluyveromyces lactis
GeneID:4331674 Os03g0157400 NP_001049014.1 Oryza sativa
GeneID:4621257 AGOS_AER190W NP_985047.1 Eremothecium gossypii

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab24115 BCRP/ABCG2 antibody [BXP-53] (ab24115); Rat monoclonal [BXP-53] to BCRP/ABCG2
2 abcam ab3380 BCRP/ABCG2 antibody [BXP-21] - Hematopoietic/Neural Stem Cell Marker (ab3380); Mouse monoclonal [BXP-21] to BCRP/ABCG2 - Hematopoietic/Neural Stem Cell Marker
3 abcam ab3379 BCRP/ABCG2 antibody [BXP-34] - Hematopoietic/Neural Stem Cell Marker (ab3379); Mouse monoclonal [BXP-34] to BCRP/ABCG2 - Hematopoietic/Neural Stem Cell Marker
4 abcam ab72788 BCRP/ABCG2 antibody [MM0047-2J39] (ab72788); Mouse monoclonal [MM0047-2J39] to BCRP/ABCG2
5 abcam ab64756 BCRP/ABCG2 antibody (ab64756); Rabbit polyclonal to BCRP/ABCG2
6 abcam ab64757 BCRP/ABCG2 antibody - Carboxyterminal end (ab64757); Rabbit polyclonal to BCRP/ABCG2 - Carboxyterminal end
7 abgent AP1490c ABCG2 Antibody (Center); Purified Rabbit Polyclonal Antibody (Pab)
8 abgent AP1490b ABCG2 Antibody (C-term); Purified Rabbit Polyclonal Antibody (Pab)
9 abnova H00009429-M01 ABCG2 monoclonal antibody (M01), clone 1G1; Mouse monoclonal antibody raised against a partial recombinant ABCG2.
10 acris AP11504PU-N CD338 / ABCG2 / BCRP1 (Center); antibody Ab
11 acris AP11503PU-N CD338 / ABCG2 / BCRP1 (C-term); antibody Ab
12 acris AM05788SU-N CD338 / ABCG2 / BCRP1; antibody Ab
13 scbt ABCG2 ABCG2 Antibody / ABCG2 Antibodies;
14 sigma B7059 Monoclonal Anti-Breast Cancer Resistance Protein antibody produced in mouse ;
15 sigma B7185 Anti-Breast Cancer Resistance Protein antibody produced in rabbit ;
16 sigma B7684 Monoclonal Anti-Breast Cancer Resistance Protein antibody produced in mouse ;

Exon, Intron and UTRs

Exon, Intron and UTRs of ABCG2 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ABCG2 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0005886 Component plasma membrane
GO:0016887 Function ATPase activity
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding
GO:0005515 Function protein binding
GO:0042803 Function protein homodimerization activity
GO:0005215 Function transporter activity
GO:0008559 Function xenobiotic-transporting ATPase activity
GO:0042493 Process response to drug
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_004827  UCSC Browser NP_004818

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000237612 MI0000102 hsa-miR-100 AACCCGUAGAUCCGAACUUGUG
ENST00000237612 MI0000269 hsa-miR-181a-2* ACCACUGACCGUUGACUGUACC
ENST00000237612 MI0000802 hsa-miR-340 UUAUAAAGCAAUGAGACUGAUU
ENST00000237612 MI0003162 hsa-miR-519d CAAAGUGCCUCCCUUUAGAGUG
ENST00000237612 MI0003149 hsa-miR-520a-3p AAAGUGCUUCCCUUUGGACUGU
ENST00000237612 MI0003155 hsa-miR-520b AAAGUGCUUCCUUUUAGAGGG
ENST00000237612 MI0003158 hsa-miR-520c-3p AAAGUGCUUCCUUUUAGAGGGU
ENST00000237612 MI0003164 hsa-miR-520d-3p AAAGUGCUUCUCUUUGGUGGGU
ENST00000237612 MI0003143 hsa-miR-520e AAAGUGCUUCCUUUUUGAGGG
ENST00000237612 MI0003146 hsa-miR-520f AAGUGCUUCCUUUUAGAGGGUU
ENST00000237612 MI0003166 hsa-miR-520g ACAAAGUGCUUCCCUUUAGAGUGU
ENST00000237612 MI0003175 hsa-miR-520h ACAAAGUGCUUCCCUUUAGAGU
ENST00000237612 MI0000389 mmu-miR-291a-3p AAAGUGCUUCCACUUUGUGUGC
ENST00000237612 MI0000392 mmu-miR-294 AAAGUGCUUCCCUUUUGUGUGU
ENST00000237612 MI0005507 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENST00000237612 MI0005508 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENST00000237612 MI0005509 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
2-Acetylaminofluorene
  • 2-Acetylaminofluorene results in increased expression of ABCG2 protein
17538966
2-Acetylaminofluorene
  • 2-Acetylaminofluorene results in increased expression of ABCG2 mRNA
  • NR1I2 protein affects the reaction [2-Acetylaminofluorene results in increased expression of ABCG2 mRNA]
16381673
2-Acetylaminofluorene
  • 2-Acetylaminofluorene results in increased expression of ABCG2 mRNA
17669244, 12819005
2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine
  • Estradiol inhibits the reaction [ABCG2 protein affects the transport of 2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine]
  • ABCG2 protein affects the transport of 2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine
  • Beclomethasone inhibits the reaction [ABCG2 protein affects the transport of 2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine]
  • Dexamethasone inhibits the reaction [ABCG2 protein affects the transport of 2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine]
  • Methylprednisolone inhibits the reaction [ABCG2 protein affects the transport of 2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine]
  • Triamcinolone inhibits the reaction [ABCG2 protein affects the transport of 2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine]
15365089
2-tert-butylhydroquinone
  • 2-tert-butylhydroquinone results in increased expression of ABCG2 mRNA
  • 2-tert-butylhydroquinone results in increased expression of ABCG2 protein
  • AHR protein promotes the reaction [2-tert-butylhydroquinone results in increased expression of ABCG2 protein]
17077187
4-methylumbelliferone
  • ABCG2 protein affects the export of 4-methylumbelliferone analog
15598971
6-prenylchrysin
  • 6-prenylchrysin results in decreased activity of ABCG2 protein
  • ABCG2 protein does not affect the transport of 6-prenylchrysin
15930306
7-hydroxymethotrexate
  • ABCG2 protein affects the transport of 7-hydroxymethotrexate
  • ABCG2 protein results in increased export of 7-hydroxymethotrexate
  • Protons promotes the reaction [ABCG2 protein results in increased export of 7-hydroxymethotrexate]
  • pantoprazole inhibits the reaction [ABCG2 protein affects the transport of 7-hydroxymethotrexate]
17032904
Acetaminophen
  • ABCG2 protein affects the export of Acetaminophen analog
15860656
Acetaminophen
  • Acetaminophen does not affect the expression of ABCG2 protein
16177239
Acetaminophen
  • Acetaminophen affects the expression of ABCG2 mRNA
17562736
Albendazole
  • ABCG2 protein does not affect the transport of Albendazole
15703302
albendazole sulfoxide
  • ABCG2 protein affects the transport of albendazole sulfoxide
  • ABCG2 protein affects the transport of albendazole sulfoxide
15703302
AN 204
  • AN 204 does not affect the expression of ABCG2 mRNA
16051478, 16047355
AN 215
  • AN 215 does not affect the expression of ABCG2 mRNA
16051478
AN 238
  • AN 238 does not affect the expression of ABCG2 mRNA
16047355
Anticonvulsants
  • ABCG2 protein results in chemical resistance to Anticonvulsants
15581025
arsenic trioxide
  • arsenic trioxide results in increased expression of ABCG2 mRNA
17547211
artesunate
  • ABCG2 protein does not affect the response to chemical artesunate
15878303
Beclomethasone
  • Beclomethasone inhibits the reaction [ABCG2 protein affects the transport of 2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine]
15365089
Benzo(a)pyrene
  • Benzo(a)pyrene results in increased expression of ABCG2 mRNA
  • Benzo(a)pyrene results in increased expression of and results in increased activity of ABCG2 protein
15917307
benzo(k)fluoranthene
  • benzo(k)fluoranthene results in increased expression of ABCG2 mRNA
  • benzo(k)fluoranthene results in increased expression of and results in increased activity of ABCG2 protein
15917307
benzo(k)fluoranthene
  • AHR protein promotes the reaction [benzo(k)fluoranthene results in increased expression of ABCG2 protein]
  • benzo(k)fluoranthene results in increased expression of ABCG2 protein
17077187
benzyloxycarbonylleucyl-leucyl-leucine aldehyde
  • benzyloxycarbonylleucyl-leucyl-leucine aldehyde promotes the reaction [indolo(3,2-b)carbazole results in increased expression of ABCG2 mRNA]
17077187
Cadmium
  • Cadmium results in increased expression of ABCG2 mRNA
17547211
Cadmium Chloride
  • Cadmium Chloride results in increased expression of ABCG2 mRNA
17547211
Carbon Tetrachloride
  • Carbon Tetrachloride does not affect the expression of ABCG2 protein
16177239
Catechin
  • Catechin results in decreased expression of ABCG2 protein
17077187
cerivastatin
  • ABCG2 protein affects the export of cerivastatin
15901800
Chromium
  • Chromium results in increased expression of ABCG2 mRNA
17547211
chrysin
  • chrysin does not affect the expression of ABCG2 protein
  • chrysin results in increased expression of ABCG2 mRNA
17077187
Cimetidine
  • ABCG2 protein affects the transport of Cimetidine
  • ABCG2 protein affects the transport of Cimetidine
15365089
Corticosterone
  • Corticosterone results in decreased activity of ABCG2 protein
15365089
Curcumin
  • AHR protein promotes the reaction [Curcumin results in increased expression of ABCG2 protein]
  • Curcumin results in increased expression of ABCG2 protein
17077187
Cyclophosphamide
  • ABCG2 protein affects the chemical susceptibility to [Fluorouracil co-treated with Epirubicin co-treated with Cyclophosphamide]
12576456
Cyclosporine
  • Cyclosporine inhibits the reaction [ABCG2 protein results in increased export of Mitoxantrone]
16636798
Cyclosporins
  • Cyclosporins affects the activity of ABCG2 protein
15788683
Dexamethasone
  • Dexamethasone inhibits the reaction [ABCG2 protein affects the transport of 2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine]
15365089
dibenzoylmethane
  • dibenzoylmethane results in increased expression of ABCG2 protein
17077187
Dietary Fats
  • Dietary Fats results in increased expression of ABCG2 mRNA
15238619
Digoxin
  • Digoxin results in decreased activity of ABCG2 protein
15365089
Dimethylnitrosamine
  • Dimethylnitrosamine results in increased expression of ABCG2 mRNA
17547211
Doxorubicin
  • ABCG2 protein results in chemical resistance to Doxorubicin
  • [[gefitinib results in decreased activity of EGFR protein] which affects the localization of ABCG2 protein] which results in decreased export of Doxorubicin
  • gefitinib inhibits the reaction [ABCG2 protein results in chemical resistance to Doxorubicin]
17938326
Doxorubicin
  • ABCG2 protein affects the transport of Doxorubicin
17273774
Doxorubicin
  • ABCG2 protein affects the chemical susceptibility to Doxorubicin
  • Doxorubicin results in increased expression of ABCG2 mRNA
  • Doxorubicin results in increased expression of ABCG2 protein
18382425
E 3040
  • ABCG2 protein affects the export of E 3040 analog
15598971
Epirubicin
  • ABCG2 protein affects the chemical susceptibility to [Fluorouracil co-treated with Epirubicin co-treated with Cyclophosphamide]
12576456
Estradiol
  • Estradiol results in decreased expression of ABCG2
  • Tamoxifen inhibits the reaction [Estradiol results in decreased expression of ABCG2]
  • [Estradiol binds to ESR1 protein] which results in decreased expression of ABCG2
15695404
Estradiol
  • Estradiol inhibits the reaction [ABCG2 protein affects the transport of 2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine]
15365089
Estrogens
  • ABCG2 protein affects the transport of Estrogens
14683478
estrone sulfate
  • ABCG2 protein affects the export of estrone sulfate
15901800
Fenbendazole
  • ABCG2 protein does not affect the transport of Fenbendazole
15703302
flavone
  • flavone results in increased expression of ABCG2 mRNA
  • flavone results in increased expression of ABCG2 protein
17077187
Flavones
  • Flavones analog results in decreased activity of ABCG2 protein
15930306
Fluorouracil
  • ABCG2 protein affects the chemical susceptibility to [Fluorouracil co-treated with Epirubicin co-treated with Cyclophosphamide]
12576456
Folic Acid
  • Folic Acid affects the localization of and affects the expression of ABCG2 protein
15657365
Folic Acid
  • ABCG2 protein affects the transport of Folic Acid
  • Protons promotes the reaction [ABCG2 protein results in increased transport of Folic Acid]
17032904
gefitinib
  • [[gefitinib results in decreased activity of EGFR protein] which affects the localization of ABCG2 protein] which results in decreased export of Doxorubicin
  • [gefitinib results in decreased activity of EGFR protein] which affects the localization of ABCG2 protein
  • gefitinib inhibits the reaction [ABCG2 protein results in chemical resistance to Doxorubicin]
17938326
Genistein
  • Genistein does not affect the expression of ABCG2 protein
17077187
GF 120918
  • GF 120918 results in decreased activity of ABCG2 protein
15930306
GF 120918
  • GF 120918 inhibits the reaction [ABCG2 protein affects the transport of resveratrol]
  • GF 120918 inhibits the reaction [Protons promotes the reaction [ABCG2 protein results in increased export of resveratrol]]
17032904
Glucuronides
  • ABCG2 protein affects the export of Glucuronides
15749994
imatinib
  • imatinib results in increased expression of ABCG2 mRNA
  • imatinib results in increased expression of and results in increased activity of ABCG2 protein
15970668
indole-3-carbinol
  • indole-3-carbinol results in increased expression of ABCG2 mRNA
17077187
indolo(3,2-b)carbazole
  • indolo(3,2-b)carbazole results in increased expression of ABCG2 mRNA
17077187, 15917307
indolo(3,2-b)carbazole
  • benzyloxycarbonylleucyl-leucyl-leucine aldehyde promotes the reaction [indolo(3,2-b)carbazole results in increased expression of ABCG2 mRNA]
17077187
indolo(3,2-b)carbazole
  • indolo(3,2-b)carbazole results in increased expression of and results in increased activity of ABCG2 protein
15917307
irinotecan
  • ABCG2 protein does not affect the secretion of irinotecan analog
16003561
irinotecan
  • ABCG2 mRNA results in chemical sensitivity to irinotecan
15239142
irinotecan
  • ABCG2 protein affects the export of irinotecan
15695404, 15655543
irinotecan
  • ABCG2 protein results in increased export of irinotecan
16271446
irinotecan
  • ABCG2 gene polymorphism affects the chemical susceptibility to and affects the metabolism of irinotecan
  • ABCG2 protein affects the metabolism of irinotecan
15801936
Iron
  • ABCG2 protein affects the metabolism of Iron
17194590
Iron, Dietary
  • Iron, Dietary affects the expression of ABCG2 mRNA
15637178
ME 3229
  • ABCG2 protein affects the transport of ME 3229 metabolite
15846469
ME 3277
  • ABCG2 protein affects the transport of ME 3277
15846469
Mercury
  • Mercury results in increased expression of ABCG2 mRNA
17547211
Methotrexate
  • ABCG2 protein affects the transport of Methotrexate
  • ABCG2 protein affects the transport of Methotrexate analog
  • ABCG2 protein results in increased export of and results in chemical resistance to Methotrexate
  • Protons promotes the reaction [ABCG2 protein results in increased export of and results in chemical resistance to Methotrexate]
17032904
methotrexate-alpha glutamate
  • ABCG2 protein does not affect the export of methotrexate-alpha glutamate
  • Protons promotes the reaction [ABCG2 protein results in increased export of methotrexate-alpha glutamate]
17032904
Methylprednisolone
  • Methylprednisolone inhibits the reaction [ABCG2 protein affects the transport of 2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine]
15365089
Mitoxantrone
  • ABCG2 protein results in chemical resistance to Mitoxantrone
  • Protons promotes the reaction [ABCG2 protein results in chemical resistance to Mitoxantrone]
17032904
Mitoxantrone
  • ABCG2 protein affects the uptake of Mitoxantrone
  • tryptoquivaline inhibits the reaction [ABCG2 protein affects the uptake of Mitoxantrone]
15640379
Mitoxantrone
  • ABCG2 protein results in increased export of Mitoxantrone
  • Cyclosporine inhibits the reaction [ABCG2 protein results in increased export of Mitoxantrone]
16636798
Mitoxantrone
  • oxfendazole inhibits the reaction [ABCG2 protein affects the transport of Mitoxantrone]
  • oxfendazole inhibits the reaction [ABCG2 protein affects the transport of Mitoxantrone]
15703302
Mitoxantrone
  • Mitoxantrone results in increased expression of ABCG2 mRNA
  • Mitoxantrone results in increased expression of ABCG2 protein
15239124
Mitoxantrone
  • ABCG2 protein affects the export of Mitoxantrone
15695404
Mitoxantrone
  • ABCG2 protein affects the transport of Mitoxantrone
17032904, 15875186
Mitoxantrone
  • ABCG2 protein affects the export of Mitoxantrone
15773906
Nelfinavir
  • Nelfinavir results in decreased activity of ABCG2 protein
16041239
NK 104
  • ABCG2 protein affects the transport of NK 104
  • ABCG2 protein affects the transport of NK 104
15955871
oxfendazole
  • ABCG2 protein affects the transport of oxfendazole
  • oxfendazole inhibits the reaction [ABCG2 protein affects the transport of Mitoxantrone]
  • oxfendazole results in decreased activity of ABCG2 protein
  • ABCG2 protein affects the transport of oxfendazole
  • oxfendazole inhibits the reaction [ABCG2 protein affects the transport of Mitoxantrone]
  • oxfendazole results in decreased activity of ABCG2 protein
15703302
pantoprazole
  • pantoprazole inhibits the reaction [ABCG2 protein affects the transport of 7-hydroxymethotrexate]
17032904
Paraquat
  • Paraquat results in increased expression of ABCG2 mRNA
12595580
PD 98059
  • PD 98059 results in decreased expression of ABCG2 mRNA
  • PD 98059 results in decreased expression of ABCG2 protein
15917307
pirinixic acid
  • pirinixic acid results in increased expression of ABCG2 mRNA
18301758, 17426115
Potassium Dichromate
  • Potassium Dichromate results in increased expression of ABCG2 mRNA
17547211
Pravastatin
  • ABCG2 protein affects the export of Pravastatin
15901800
Progesterone
  • Progesterone does not affect the expression of ABCG2 mRNA
  • Progesterone does not affect the expression of ABCG2 protein
17524480
Protons
  • GF 120918 inhibits the reaction [Protons promotes the reaction [ABCG2 protein results in increased export of resveratrol]]
  • Protons promotes the reaction [ABCG2 protein results in chemical resistance to Mitoxantrone]
  • Protons promotes the reaction [ABCG2 protein results in increased export of 7-hydroxymethotrexate]
  • Protons promotes the reaction [ABCG2 protein results in increased export of and results in chemical resistance to Methotrexate]
  • Protons promotes the reaction [ABCG2 protein results in increased export of methotrexate-alpha glutamate]
  • Protons promotes the reaction [ABCG2 protein results in increased export of resveratrol]
  • Protons promotes the reaction [ABCG2 protein results in increased transport of Folic Acid]
  • Protons promotes the reaction [ABCG2 protein results in increased transport of Topotecan]
  • Protons promotes the reaction [ABCG2 protein results in increased transport of Topotecan]
17032904
Quercetin
  • ABCG2 protein affects the export of Quercetin
  • ABCG2 protein affects the export of Quercetin metabolite
15749994
Quercetin
  • AHR protein promotes the reaction [Quercetin results in increased expression of ABCG2 protein]
  • Quercetin results in increased expression of ABCG2 mRNA
  • Quercetin results in increased expression of ABCG2 protein
17077187
resveratrol
  • ABCG2 protein affects the transport of resveratrol
  • ABCG2 protein does not affect the export of resveratrol
  • GF 120918 inhibits the reaction [ABCG2 protein affects the transport of resveratrol]
  • GF 120918 inhibits the reaction [Protons promotes the reaction [ABCG2 protein results in increased export of resveratrol]]
  • Protons promotes the reaction [ABCG2 protein results in increased export of resveratrol]
17032904
resveratrol
  • AHR protein promotes the reaction [resveratrol results in increased expression of ABCG2 protein]
  • resveratrol results in increased expression of ABCG2 mRNA
  • resveratrol results in increased expression of ABCG2 protein
17077187
Silymarin
  • AHR protein promotes the reaction [Silymarin results in increased expression of ABCG2 protein]
  • Silymarin results in increased expression of ABCG2 protein
17077187
sitosterol
  • ABCG2 protein does not affect the transport of sitosterol
12488046
Tamoxifen
  • Tamoxifen inhibits the reaction [Estradiol results in decreased expression of ABCG2]
15695404
taxane
  • taxane analog affects the activity of ABCG2 protein
15771464
tectochrysin
  • ABCG2 protein does not affect the transport of tectochrysin
  • tectochrysin results in decreased activity of ABCG2 protein
15930306
Tetrachlorodibenzodioxin
  • Tetrachlorodibenzodioxin results in increased expression of ABCG2 mRNA
  • Tetrachlorodibenzodioxin results in increased expression of and results in increased activity of ABCG2 protein
15917307
Tetrachlorodibenzodioxin
  • Tetrachlorodibenzodioxin results in increased expression of ABCG2 protein
17077187
Topotecan
  • ABCG2 protein affects the transport of Topotecan
17032904, 15875186
Topotecan
  • ABCG2 protein results in increased transport of Topotecan
  • Protons promotes the reaction [ABCG2 protein results in increased transport of Topotecan]
  • ABCG2 protein affects the transport of Topotecan
  • ABCG2 protein results in increased transport of Topotecan
  • Protons promotes the reaction [ABCG2 protein results in increased transport of Topotecan]
17032904
Topotecan
  • ABCG2 protein affects the export of Topotecan
15695404
Triamcinolone
  • Triamcinolone inhibits the reaction [ABCG2 protein affects the transport of 2-amino-1-methyl-6-phenylimidazo(4,5-b)pyridine]
15365089
tryptoquivaline
  • tryptoquivaline analog results in decreased activity of ABCG2 protein
15917307
tryptoquivaline
  • tryptoquivaline results in decreased activity of ABCG2 protein
15749994
tryptoquivaline
  • tryptoquivaline inhibits the reaction [ABCG2 protein affects the uptake of Mitoxantrone]
15640379
valspodar
  • valspodar does not affect the activity of ABCG2 protein
15788683

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Breast Neoplasms marker 10930538
Mammary Neoplasms, Experimental inferred via valspodar 14633655
Neuroblastoma inferred via Topotecan 15176712
Adenoma, Liver Cell inferred via Tetrachlorodibenzodioxin 16835633
Carcinoma inferred via Tetrachlorodibenzodioxin 16835633
Cholangiocarcinoma inferred via Tetrachlorodibenzodioxin 16835633
Cleft Palate inferred via Tetrachlorodibenzodioxin 8697196
Diabetes Mellitus, Type 2 inferred via Tetrachlorodibenzodioxin 17107852
Hydronephrosis inferred via Tetrachlorodibenzodioxin 8697196
Liver Neoplasms inferred via Tetrachlorodibenzodioxin 16984957
Breast Neoplasms inferred via Tamoxifen 16202921, 15668708, 17440819, 17893378, 17261762, 17049068, 16873071, 16818667, 11161223, 17242785, 15565566
Carcinoma, Hepatocellular inferred via Tamoxifen 16924424
Carcinoma, Transitional Cell inferred via Tamoxifen 17572228
Endometrial Neoplasms inferred via Tamoxifen 16202921, 17893378
Fatty Liver inferred via Tamoxifen 14986274
Female Urogenital Diseases inferred via Tamoxifen 16709447
Lipidoses inferred via Tamoxifen 15342952
Liver Cirrhosis, Experimental inferred via Tamoxifen 18564211
Liver Neoplasms inferred via Tamoxifen 16684651
Mammary Neoplasms, Experimental inferred via Tamoxifen 11731420, 14580682, 16827153
Melanoma inferred via Tamoxifen 12393984
Melanoma, Amelanotic inferred via Tamoxifen 15990972
Spermatocele inferred via Tamoxifen 16709447
Urinary Bladder Neoplasms inferred via Tamoxifen 16712894, 17572228
Inflammation inferred via Silymarin 17213517
Liver Cirrhosis inferred via Silymarin 17213517
Liver Cirrhosis, Experimental inferred via Silymarin 15754394, 17198567, 15864749, 18277467
Liver Diseases inferred via Silymarin 17213517
Liver Diseases, Alcoholic inferred via Silymarin 17213517
Mushroom Poisoning inferred via Silymarin 17213517
Adenoma inferred via resveratrol 15688382
Alzheimer Disease inferred via resveratrol 16183991, 16162502
Arthritis, Experimental inferred via resveratrol 17115116
Atherosclerosis inferred via resveratrol 16873680, 17967414
Brain Ischemia inferred via resveratrol 17600658
Breast Neoplasms inferred via resveratrol 17651959, 17534123, 16393696
Carcinoma, Hepatocellular inferred via resveratrol 16227395
Carcinoma, Lewis Lung inferred via resveratrol 16675471
Carcinoma, Squamous Cell inferred via resveratrol 16227395
Cardiovascular Diseases inferred via resveratrol 15458977
Colitis inferred via resveratrol 16474422
Colonic Neoplasms inferred via resveratrol 16338953
Colorectal Neoplasms inferred via resveratrol 16550006
Diabetes Mellitus, Experimental inferred via resveratrol 16873680
Diabetic Nephropathies inferred via resveratrol 16286809
Edema inferred via resveratrol 8985016
Encephalomyelitis, Autoimmune, Experimental inferred via resveratrol 17872969
Enterocolitis, Necrotizing inferred via resveratrol 17923197
Herpes Simplex inferred via resveratrol 16876885
Hypercholesterolemia inferred via resveratrol 17188708
Hyperlipidemias inferred via resveratrol 16873680
Hypertrophy, Left Ventricular inferred via resveratrol 17488730
Infarction, Middle Cerebral Artery inferred via resveratrol 17600658
Inflammation inferred via resveratrol 16366677
Influenza, Human inferred via resveratrol 16624496
Kidney Failure, Acute inferred via resveratrol 16538975
Leukemia, Promyelocytic, Acute inferred via resveratrol 16087638
Lymphoma, B-Cell inferred via resveratrol 17088997
Lymphoma, Non-Hodgkin inferred via resveratrol 14749477
Mammary Neoplasms, Animal inferred via resveratrol 15688416
Mammary Neoplasms, Experimental inferred via resveratrol 8985016, 11606380
Melanoma inferred via resveratrol 17992120
Metabolic Diseases inferred via resveratrol 17112576
Multiple Myeloma inferred via resveratrol 14749477, 17164350, 16490592, 16267019, 17049120, 17935668
Muscular Atrophy, Spinal inferred via resveratrol 17962980
Myocardial Infarction inferred via resveratrol 17188708, 16456233, 16317513, 17015251, 16525036, 17125593
Myocardial Ischemia inferred via resveratrol 17125593, 17015251
Myocarditis inferred via resveratrol 17322642
Neoplasms, Experimental inferred via resveratrol 8985016
Neurodegenerative Diseases inferred via resveratrol 17652729
Neurogenic Inflammation inferred via resveratrol 17929310
Osteoporosis, Postmenopausal inferred via resveratrol 17513867
Prenatal Exposure Delayed Effects inferred via resveratrol 16679765
Prostatic Neoplasms inferred via resveratrol 17675339, 17804756, 15767336, 16731767, 17636462, 17718901
Renal Insufficiency, Chronic inferred via resveratrol 16325855
Reperfusion Injury inferred via resveratrol 17058453, 15827377, 16317513, 17520802, 16314181
Skin Neoplasms inferred via resveratrol 15837718, 8985016
STROKE, ISCHEMIC inferred via resveratrol 16321402
Tongue Neoplasms inferred via resveratrol 16227395
Uterine Cervical Neoplasms inferred via resveratrol 17473185
Uterine Neoplasms inferred via resveratrol 17044934
Ventricular Dysfunction, Left inferred via resveratrol 17488730
Cadmium Poisoning inferred via Quercetin 16962696
Influenza, Human inferred via Quercetin 16624496
Kidney Diseases inferred via Quercetin 16962696
Liver Cirrhosis, Experimental inferred via Quercetin 12741479
Neurogenic Inflammation inferred via Quercetin 17929310
Pancreatic Neoplasms inferred via Quercetin 16965848
Brain Hemorrhage, Traumatic inferred via Progesterone 17868700
Brain Injuries inferred via Progesterone 15665606, 15845082, 15380490
Breast Neoplasms inferred via Progesterone 17614352, 16175315, 15562024
Diabetic Neuropathies inferred via Progesterone 17187935
Encephalomyelitis, Autoimmune, Experimental inferred via Progesterone 17692515
Endometriosis inferred via Progesterone 16134523
Mammary Neoplasms, Experimental inferred via Progesterone 17203775, 11408345
Ovarian Neoplasms inferred via Progesterone 17393432, 16525653
Salivary Gland Neoplasms inferred via Progesterone 18045962
Spinal Cord Injuries inferred via Progesterone 15862959, 16503802
Hypercholesterolemia inferred via Pravastatin 17188708
Myocardial Infarction inferred via Pravastatin 17188708
Edema inferred via pirinixic acid 12083418
Liver Neoplasms inferred via pirinixic acid 15890375
Leukemia, Monocytic, Acute inferred via PD 98059 16972261
Agricultural Workers' Diseases inferred via Paraquat 11874814
Gliosis inferred via Paraquat 11124998
Nerve Degeneration inferred via Paraquat 16893418
Parkinson Disease inferred via Paraquat 12911755, 15824117, 16140633, 15451049, 11124998, 16510128, 11445065, 11181820
Pneumonia inferred via Paraquat 12504350
Pulmonary Fibrosis inferred via Paraquat 16324872, 17997886
Respiratory Distress Syndrome, Adult inferred via Paraquat 11700416
Respiratory Sounds inferred via Paraquat 11874814
Retinal Degeneration inferred via Paraquat 16458197
Heart Failure inferred via NK 104 15502390
HIV Infections inferred via Nelfinavir 15388451
Heart Diseases inferred via Mitoxantrone 16019553
Leukemia, Lymphocytic, Chronic, B-Cell inferred via Mitoxantrone 18172266
Neoplasms inferred via Mitoxantrone 16640825
Leukemia, Lymphocytic, Chronic, B-Cell inferred via Methylprednisolone 14551737
Arthritis, Rheumatoid inferred via Methotrexate 17286800
Breast Neoplasms inferred via Methotrexate 16978400
Graft vs Host Disease inferred via Methotrexate 16518429
Liver Cirrhosis inferred via Methotrexate 14986274
Mucositis inferred via Methotrexate 17488658
Psoriasis inferred via Methotrexate 17410198
Autoimmune Diseases inferred via Mercury 16634805
alpha 1-Antitrypsin Deficiency inferred via Iron 16640825
Alzheimer Disease inferred via Iron 16640825, 16563566
Anemia inferred via Iron 16566752, 16434484
Anemia, Iron-Deficiency inferred via Iron 17162259, 17147795, 17375513, 17163184, 16569441
Anemia, Sideroblastic inferred via Iron 16910769
Arrhythmias, Cardiac inferred via Iron 16604332
Atherosclerosis inferred via Iron 16640825, 16632123
Bacterial Infections inferred via Iron 16640825
Cardiomyopathies inferred via Iron 16640825
Cardiomyopathy, Dilated inferred via Iron 16604332
Colonic Neoplasms inferred via Iron 16640825
Diabetes Mellitus inferred via Iron 16640825, 16604332
Diabetes Mellitus, Type 1 inferred via Iron 16506275
Diabetes Mellitus, Type 2 inferred via Iron 16506275
Fatty Liver inferred via Iron 16640825
Friedreich Ataxia inferred via Iron 16640825, 16604332
Hemochromatosis inferred via Iron 17236123, 16574947, 16604332, 16640825, 17053826, 17255318
Hemosiderosis inferred via Iron 16604332
Hepatitis, Viral, Human inferred via Iron 16640825
Hepatolenticular Degeneration inferred via Iron 17182432
Hepatomegaly inferred via Iron 16890145
HIV Infections inferred via Iron 16597321
Hypogonadism inferred via Iron 16640825
Hypothyroidism inferred via Iron 16640825
Iron Metabolism Disorders inferred via Iron 17163184
Lewy Body Disease inferred via Iron 16563566
Liver Cirrhosis inferred via Iron 16640825
Liver Diseases, Alcoholic inferred via Iron 17207112, 16737972
Liver Neoplasms inferred via Iron 16640825
Lung Neoplasms inferred via Iron 16640825
Macular Degeneration inferred via Iron 16640825
Multiple Sclerosis, Chronic Progressive inferred via Iron 17086897
Mycoses inferred via Iron 16640825
Myocardial Ischemia inferred via Iron 16604332
Myocardial Reperfusion Injury inferred via Iron 16604332
Nephrotic Syndrome inferred via Iron 17178036
Neurodegenerative Diseases inferred via Iron 17296847, 16604332
Osteoarthritis inferred via Iron 16640825
Osteoporosis inferred via Iron 16640825, 16648989
Parkinson Disease inferred via Iron 16640825, 16563566
Pituitary Diseases inferred via Iron 16604332
Poisoning inferred via Iron 16604332
Porphyria Cutanea Tarda inferred via Iron 16640825
Pre-Eclampsia inferred via Iron 16640825
Protozoan Infections inferred via Iron 16640825
Restless Legs Syndrome inferred via Iron 16930377
Sudden Infant Death inferred via Iron 16640825
Tuberculosis inferred via Iron 16597321
Colonic Neoplasms inferred via irinotecan 17725105
Colorectal Neoplasms inferred via irinotecan 16303861, 17454858, 18259882, 15273666
Neoplasm Metastasis inferred via irinotecan 18259882
Stomach Neoplasms inferred via irinotecan 15723263
Breast Neoplasms inferred via indole-3-carbinol 16082211
Uterine Cervical Neoplasms inferred via indole-3-carbinol 16082211
Breast Neoplasms inferred via imatinib 17614352
Leukemia, Myelogenous, Chronic, BCR-ABL Positive inferred via imatinib 15748426, 17301526
Liver Cirrhosis, Experimental inferred via imatinib 16596278
Neoplasms, Hormone-Dependent inferred via imatinib 17614352
Precursor Cell Lymphoblastic Leukemia-Lymphoma inferred via imatinib 12476293
Thyroid Neoplasms inferred via imatinib 16940797
Breast Neoplasms inferred via Genistein 17200150, 16873071, 16541309
Carcinoma, Hepatocellular inferred via Genistein 16924424
Cardiovascular Diseases inferred via Genistein 16332659
Colonic Neoplasms inferred via Genistein 17182828
Diabetes Mellitus, Type 2 inferred via Genistein 16647724
Endometrial Hyperplasia inferred via Genistein 16402032
Glioblastoma inferred via Genistein 16598420
Liver Cirrhosis, Experimental inferred via Genistein 17823541
Mammary Neoplasms, Experimental inferred via Genistein 14578162, 12929590
Myocardial Infarction inferred via Genistein 17141266
Myocardial Reperfusion Injury inferred via Genistein 17141266
Osteoporosis, Postmenopausal inferred via Genistein 16169203
Prostatic Neoplasms inferred via Genistein 16925846, 15256057, 15378649
Carcinoma, Non-Small-Cell Lung inferred via gefitinib 16230376, 17290066, 15496427
Colorectal Neoplasms inferred via gefitinib 17594712
Mammary Neoplasms, Experimental inferred via gefitinib 18375820
Prostatic Neoplasms inferred via gefitinib 15651060, 17914592, 16685379
Thyroid Neoplasms inferred via gefitinib 16940797
Adenoma inferred via Folic Acid 16963246
Alzheimer Disease inferred via Folic Acid 17116317
Breast Neoplasms inferred via Folic Acid 16777985
Cardiovascular Diseases inferred via Folic Acid 16755160
Colorectal Neoplasms inferred via Folic Acid 16963246, 17116713, 17087956, 16985020, 17245555
Diabetes Mellitus, Type 2 inferred via Folic Acid 16886840
Endometrial Neoplasms inferred via Folic Acid 17301261
Exfoliation Syndrome inferred via Folic Acid 16504073
Gastritis inferred via Folic Acid 17171786
Glaucoma inferred via Folic Acid 16504073
Heart Defects, Congenital inferred via Folic Acid 17286298, 16524890
HIV Seropositivity inferred via Folic Acid 17209195
Hyperhomocysteinemia inferred via Folic Acid 16397167, 16865747, 16395265, 16755160, 16433478
Liver Diseases inferred via Folic Acid 16877991
Lupus Erythematosus, Systemic inferred via Folic Acid 17718048
Maxillofacial Abnormalities inferred via Folic Acid 16832597
Neural Tube Defects inferred via Folic Acid 17438019
Neutropenia inferred via Folic Acid 16322990
Schizophrenia inferred via Folic Acid 16641680
Spinal Cord Diseases inferred via Folic Acid 16361298
Stomach Neoplasms inferred via Folic Acid 17171786
Stroke inferred via Folic Acid 16517955
Breast Neoplasms inferred via Fluorouracil 15136595
Carcinoid Tumor inferred via Fluorouracil 16051944
Colonic Neoplasms inferred via Fluorouracil 17725105
Colorectal Neoplasms inferred via Fluorouracil 17594712, 17401013, 17695437, 17255274, 17454858, 16303861
Breast Neoplasms inferred via estrone sulfate 17261762
Critical Illness inferred via Estrogens 16670151
Wounds and Injuries inferred via Estrogens 11172683
Breast Neoplasms inferred via Estradiol 17289903, 14630087, 12948864, 18497071, 17018787, 17261762
Candidiasis, Vulvovaginal inferred via Estradiol 16111702
Carcinoma, Hepatocellular inferred via Estradiol 16924424
Herpes Genitalis inferred via Estradiol 15709030
Hot Flashes inferred via Estradiol 17088409
Insulin Resistance inferred via Estradiol 16393666, 16627594
Kidney Diseases inferred via Estradiol 15618244
Kidney Neoplasms inferred via Estradiol 15610895
Liver Cirrhosis, Experimental inferred via Estradiol 14716833, 14659978
Mammary Neoplasms, Experimental inferred via Estradiol 17203775, 11807958, 16891317, 11408345
Myocardial Reperfusion Injury inferred via Estradiol 16810080
Neovascularization, Pathologic inferred via Estradiol 17289903
Prostatic Neoplasms inferred via Estradiol 16740699
Breast Neoplasms inferred via Epirubicin 17388661, 18511948, 15093573, 12006526
Hodgkin Disease inferred via Epirubicin 18180244
Adenocarcinoma inferred via Doxorubicin 17418594
Bone Marrow Neoplasms inferred via Doxorubicin 14601052
Brain Neoplasms inferred via Doxorubicin 17150277
Breast Neoplasms inferred via Doxorubicin 15692762, 15939500, 17426702, 17983394, 18628466, 15136595, 11325840, 16322301, 16096432, 15993339, 15634643, 15567936, 15994142, 15668708, 16264153, 18234424, 17369602, 16935488, 18382427, 16826403
Carcinoid Tumor inferred via Doxorubicin 16051944
Carcinoma, Hepatocellular inferred via Doxorubicin 18059187, 17876044, 16023760, 16234567
Carcinoma, Renal Cell inferred via Doxorubicin 16201981
Cardiomyopathies inferred via Doxorubicin 16952015, 17382496, 16731534, 18627295, 17131338, 16651473, 15505089, 16278810, 15476868, 16269455, 16109756, 16242529, 16364871, 17351982, 16455267, 17329180, 17974986, 17308081, 17007740, 15811867
Cardiomyopathy, Dilated inferred via Doxorubicin 17334414, 16243910
Colorectal Neoplasms inferred via Doxorubicin 18259882
Drug Toxicity inferred via Doxorubicin 18602426
Endometrial Neoplasms inferred via Doxorubicin 17359293
Endomyocardial Fibrosis inferred via Doxorubicin 18037988
Glioblastoma inferred via Doxorubicin 17150277
Head and Neck Neoplasms inferred via Doxorubicin 15692506
Heart Diseases inferred via Doxorubicin 16707910, 16879835, 16244371, 16244372, 16144979, 16330681
Hemangiosarcoma inferred via Doxorubicin 15692506
Hepatitis, Toxic inferred via Doxorubicin 17416283
Hodgkin Disease inferred via Doxorubicin 17606976, 15147373, 18501091
Kidney Diseases inferred via Doxorubicin 16775033, 15369732
Kidney Failure inferred via Doxorubicin 17922066
Kidney Failure, Chronic inferred via Doxorubicin 16707910
Leukemia, Erythroblastic, Acute inferred via Doxorubicin 16085563
Liver Cirrhosis, Experimental inferred via Doxorubicin 16595196, 16439617
Liver Neoplasms, Experimental inferred via Doxorubicin 17085340, 16842330
Lung Neoplasms inferred via Doxorubicin 17418594
Lymphoma inferred via Doxorubicin 16098063
Lymphoma, Non-Hodgkin inferred via Doxorubicin 17654614
Lymphoma, T-Cell inferred via Doxorubicin 15621674
Mammary Neoplasms, Experimental inferred via Doxorubicin 15458769
Melanoma inferred via Doxorubicin 16827129
Mucositis inferred via Doxorubicin 17415656
Neoplasm Metastasis inferred via Doxorubicin 18259882
Nephrotic Syndrome inferred via Doxorubicin 15640375, 16889571
Neuroblastoma inferred via Doxorubicin 15555623
Osteosarcoma inferred via Doxorubicin 15930896
Phyllodes Tumor inferred via Doxorubicin 17983394
Prostatic Neoplasms inferred via Doxorubicin 15897917, 16868541, 18437689, 15749863, 16888761, 16729912
Sarcoma inferred via Doxorubicin 18313854, 17710206, 16767912, 15675481, 15625365, 17203757
Sarcoma, Ewing's inferred via Doxorubicin 14601052, 16326096
Sarcoma, Kaposi inferred via Doxorubicin 17846226
Skin Neoplasms inferred via Doxorubicin 15692506
Soft Tissue Neoplasms inferred via Doxorubicin 16767912, 15625365, 17203757
Thyroid Neoplasms inferred via Doxorubicin 17909728, 16010429
Urinary Bladder Neoplasms inferred via Doxorubicin 17653716
Ventricular Dysfunction, Left inferred via Doxorubicin 17334414, 16364871
Adenocarcinoma inferred via Dimethylnitrosamine 16033868
Carcinoma, Squamous Cell inferred via Dimethylnitrosamine 16033868
Esophageal Neoplasms inferred via Dimethylnitrosamine 17016578
Liver Cirrhosis, Experimental inferred via Dimethylnitrosamine 17203207, 17036385, 18095165, 14568256, 15763062, 16544323, 15842777, 15793283, 18371158, 12925901, 15366600, 17348192, 17201889, 15504291, 17666798, 15138612, 16603200, 17724770, 15723089, 14726149, 16627068, 15942678, 17198567, 15086199, 15733078, 16009107, 18637143, 18672772, 15067225, 17640959, 18364076, 15369754, 15099470, 14709902, 15577212, 15339415, 17432682, 15744066, 15591649, 18239293, 16270385, 17881167, 15492853, 18629640, 15864749, 18237412, 17719030, 15081153, 16169303, 14643895, 18567088, 15798949, 15571005, 15161499, 12918455, 15298665, 16042886, 15479170, 17196135, 15383259, 14659978, 16570917, 17465448, 17534399, 18210741
Liver Failure, Acute inferred via Dimethylnitrosamine 17457977
Liver Neoplasms inferred via Dimethylnitrosamine 3113478, 15890375
Liver Neoplasms, Experimental inferred via Dimethylnitrosamine 15603536
Lung Neoplasms inferred via Dimethylnitrosamine 16061637
Stomach Neoplasms inferred via Dimethylnitrosamine 16033868
Arteriosclerosis inferred via Dietary Fats 15238619
Dyslipidemias inferred via Dietary Fats 18367378
Insulin Resistance inferred via Dietary Fats 18457598
Obesity inferred via Dietary Fats 18457598, 17217161
Adenomatous Polyposis Coli inferred via dibenzoylmethane 17942926
Colonic Neoplasms inferred via Dexamethasone 15824018
Liver Cirrhosis, Experimental inferred via Dexamethasone 16718785
Lung Neoplasms inferred via Dexamethasone 15824018, 11195469
Multiple Myeloma inferred via Dexamethasone 15867202, 15744524, 16118317
Respiratory Distress Syndrome, Adult inferred via Dexamethasone 11700416
Gingival Hyperplasia inferred via Cyclosporine 8708960
Metal Metabolism, Inborn Errors inferred via Cyclosporine 16801185
Nephrosis, Lipoid inferred via Cyclosporine 17954296
Nephrotic Syndrome inferred via Cyclosporine 18481113
Psoriasis inferred via Cyclosporine 16882103
Arteriosclerosis inferred via Cyclophosphamide 15014928
Breast Neoplasms inferred via Cyclophosphamide 17388661, 11325840, 18323546, 18234424, 12006526, 15093573, 15136595, 16978400
Carcinoma, Lewis Lung inferred via Cyclophosphamide 16152834
Carcinoma, Renal Cell inferred via Cyclophosphamide 16201981
Cystitis inferred via Cyclophosphamide 11948286, 17010015, 10700343, 16413132, 17979934, 18483878, 15643279, 16651033, 16989017, 12388444, 10498854, 12913760, 18710439, 15276878, 18433785, 18295254, 16614059
Diabetes Mellitus, Experimental inferred via Cyclophosphamide 11751995, 10990075, 15331540
Diabetes Mellitus, Type 1 inferred via Cyclophosphamide 18772604
Eosinophilia inferred via Cyclophosphamide 11006010
Gliosarcoma inferred via Cyclophosphamide 11389073
GLOBOZOOSPERMIA inferred via Cyclophosphamide 16517039
Graft vs Host Disease inferred via Cyclophosphamide 11014644, 16376943, 15172196
Hemophilia A inferred via Cyclophosphamide 11918545
Hepatic Veno-Occlusive Disease inferred via Cyclophosphamide 14986274
Hodgkin Disease inferred via Cyclophosphamide 17606976, 16135485
Infertility, Male inferred via Cyclophosphamide 16517039
Leukemia inferred via Cyclophosphamide 10602166
Leukemia, Lymphocytic, Chronic, B-Cell inferred via Cyclophosphamide 18587576, 17658394, 18172266, 17802794, 17296974, 17008537
Leukopenia inferred via Cyclophosphamide 10052129, 11830472
Lymphoma inferred via Cyclophosphamide 12854902
Lymphoma, B-Cell inferred via Cyclophosphamide 16675587
Lymphoma, Non-Hodgkin inferred via Cyclophosphamide 11911406
Melanoma, Experimental inferred via Cyclophosphamide 16388313
Neuroblastoma inferred via Cyclophosphamide 16115947, 15176712
Oligospermia inferred via Cyclophosphamide 16517039
Pancreatic Neoplasms inferred via Cyclophosphamide 11332152
Prostatic Neoplasms inferred via Cyclophosphamide 17136230
Pulmonary Fibrosis inferred via Cyclophosphamide 16636934
Scleroderma, Systemic inferred via Cyclophosphamide 16636934
Urinary Bladder Neoplasms inferred via Cyclophosphamide 14692829
Breast Neoplasms inferred via Curcumin 16243823
Inflammation inferred via Curcumin 16956363, 17151092
Leukemia-Lymphoma, Adult T-Cell inferred via Curcumin 16106398
Leukemia, T-Cell inferred via Curcumin 16106398
Liver Cirrhosis, Experimental inferred via Curcumin 18006644
Liver Diseases inferred via Curcumin 16956363
Lung Neoplasms inferred via Curcumin 16243823
Lymphoma, T-Cell inferred via Curcumin 16173963
Memory Disorders inferred via Curcumin 17263510
Muscular Atrophy, Spinal inferred via Curcumin 17962980
Respiratory Distress Syndrome, Adult inferred via Curcumin 10666014
Mammary Neoplasms, Experimental inferred via Corticosterone 12807724
Breast Neoplasms inferred via Chromium 15986119
Carbon Tetrachloride Poisoning inferred via Carbon Tetrachloride 16192424, 16124888, 16227642, 15673190, 16011737, 10355542, 15700767, 16097048, 16050911
Fatty Liver inferred via Carbon Tetrachloride 16045604, 12795759, 61145, 12631006, 17595544, 15959796, 16239168
Hepatitis, Toxic inferred via Carbon Tetrachloride 17522070, 15998439, 15027814, 15968718, 16227642, 16177239, 11566570
Hyperbilirubinemia inferred via Carbon Tetrachloride 16899240
Liver Cirrhosis inferred via Carbon Tetrachloride 17174718, 17334410, 16239168, 16221502, 16943688
Liver Cirrhosis, Experimental inferred via Carbon Tetrachloride 16192424, 15925388, 16116963, 17525996, 17557913, 18277467, 18205269, 14716496, 15730626, 12632514, 15052691, 12632512, 17766677, 18418968, 18395914, 18279442, 16027843, 15996030, 16033810, 17565644, 17869086, 17708605, 12667390, 16136751, 17481882, 17900296, 15123356, 18339082, 18429990, 12546737, 18006644, 18481824, 12445421, 12445418, 15959796, 12898905, 18317297, 17761835, 14620537, 18472332, 14716833, 16015684, 12741479, 14724832, 18472094, 15931870, 17698563, 15893842, 12958196, 17640975, 18376398, 12389079, 18187930, 18210741, 18412020, 17714472, 14512876, 12609069, 18166357, 17922224, 18420326, 15876570, 15057751, 12586293, 18054572, 10355542, 16011737, 18251166, 17823541, 17944888, 14748882, 13678700, 15818738, 17631135, 16097048, 15673190, 12649538, 17721639, 12666154, 16638106, 18395095, 18156304, 17976157, 17805973, 16248980
Liver Diseases inferred via Carbon Tetrachloride 16246199, 16964402, 17285989, 15830285, 15720792
Liver Failure inferred via Carbon Tetrachloride 15123358
Liver Failure, Acute inferred via Carbon Tetrachloride 14706259, 16899240
Liver Neoplasms, Experimental inferred via Carbon Tetrachloride 15583823
Kidney Diseases inferred via Cadmium Chloride 16962696
Cell Transformation, Neoplastic inferred via Cadmium 17332340
Kidney Diseases inferred via Cadmium 16962696, 16322080
Prostatic Neoplasms inferred via Cadmium 17075824
Esophageal Neoplasms inferred via Benzo(a)pyrene 16530937
Lung Neoplasms inferred via Benzo(a)pyrene 17053015
Urinary Bladder Neoplasms inferred via Benzo(a)pyrene 17053015
Melanoma inferred via artesunate 16273263
Adenocarcinoma inferred via arsenic trioxide 11798837
Blood Coagulation Disorders inferred via arsenic trioxide 16206674
Burkitt Lymphoma inferred via arsenic trioxide 11589617
Carcinoma, Hepatocellular inferred via arsenic trioxide 16217749, 14691202, 15553829, 15073043, 11135700
Carcinoma, Small Cell inferred via arsenic trioxide 12490120
Coronary Restenosis inferred via arsenic trioxide 12609071
Death, Sudden, Cardiac inferred via arsenic trioxide 15213294
Esophageal Neoplasms inferred via arsenic trioxide 12903497
Fatty Liver inferred via arsenic trioxide 15073043
Gallbladder Neoplasms inferred via arsenic trioxide 16904648
Leukemia inferred via arsenic trioxide 15070760
Leukemia-Lymphoma, Adult T-Cell inferred via arsenic trioxide 12560223, 17077332
Leukemia, Monocytic, Acute inferred via arsenic trioxide 16972261
Leukemia, Myelogenous, Chronic, BCR-ABL Positive inferred via arsenic trioxide 14633726
Leukemia, Myeloid, Acute inferred via arsenic trioxide 16467208, 17050201, 16968895
Leukemia, Promyelocytic, Acute inferred via arsenic trioxide 16891316, 16330433, 12712474, 16966277, 15622746, 16823087, 11161223, 16331271, 17217047, 17107899, 15748426, 15336539, 15213294, 12679006, 11468182
Leukemia, T-Cell inferred via arsenic trioxide 16882451
Liver Neoplasms inferred via arsenic trioxide 14682389
Long QT Syndrome inferred via arsenic trioxide 15213294
Lung Neoplasms inferred via arsenic trioxide 11798837
Multiple Myeloma inferred via arsenic trioxide 15949261, 11468182, 14977855
Myelodysplastic Syndromes inferred via arsenic trioxide 16105982, 16882451
Neoplasm Invasiveness inferred via arsenic trioxide 16624393
Ovarian Neoplasms inferred via arsenic trioxide 16624393, 12452020
Pancreatic Neoplasms inferred via arsenic trioxide 15580305
Sarcoma, Ewing's inferred via arsenic trioxide 16646077
Stomach Neoplasms inferred via arsenic trioxide 17007042
Torsades de Pointes inferred via arsenic trioxide 15213294
Urinary Bladder Neoplasms inferred via arsenic trioxide 12973940, 11780464, 12845720
Hepatitis, Toxic inferred via Acetaminophen 2444490, 15968718, 16227642, 16177239, 14986274, 17562736, 17522070, 16081117
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215
Adenoma inferred via 2-Acetylaminofluorene 10737359
Carcinoma, Hepatocellular inferred via 2-Acetylaminofluorene 10737359
Liver Neoplasms inferred via 2-Acetylaminofluorene 10737359, 10672840, 11376686, 16273603, 18001218, 14678523
Lung Neoplasms inferred via 2-Acetylaminofluorene 11376686
Urinary Bladder Neoplasms inferred via 2-Acetylaminofluorene 15867355, 15289314

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Xiong H, et al. (2009) "ABCG2 is upregulated in Alzheimer's brain with cerebral amyloid angiopathy and may act as a gatekeeper at the blood-brain barrier for Abeta(1-40) peptides." J Neurosci. 29(17):5463-5475. PMID:19403814
  2. [ + ] Miura M, et al. (2009) "Telmisartan pharmacokinetics in Japanese renal transplant recipients." Clin Chim Acta. 399(1-2):83-87. PMID:18838068
  3. [ + ] Lemos C, et al. (2009) "Impact of cellular folate status and epidermal growth factor receptor expression on BCRP/ABCG2-mediated resistance to gefitinib and erlotinib." Br J Cancer. 100(7):1120-1127. PMID:19277036
  4. [ + ] Alt R, et al. (2009) "ABCG2 expression is correlated neither to side population nor to hematopoietic progenitor function in human umbilical cord blood." Exp Hematol. 37(2):294-301. PMID:19101070
  5. [ + ] Goekkurt E, et al. (2009) "Pharmacogenetic analyses of hematotoxicity in advanced gastric cancer patients receiving biweekly fluorouracil, leucovorin, oxaliplatin and docetaxel (FLOT): a translational study of the Arbeitsgemeinschaft Internistische Onkologie (AIO)." Ann Oncol. 20(3):481-485. PMID:19074750
  6. [ + ] van de Wetering K, et al. (2009) "Intestinal breast cancer resistance protein (BCRP)/Bcrp1 and multidrug resistance protein 3 (MRP3)/Mrp3 are involved in the pharmacokinetics of resveratrol." Mol Pharmacol. 75(4):876-885. PMID:19114588
  7. [ + ] Lemos C, et al. (2009) "Cellular folate status modulates the expression of BCRP and MRP multidrug transporters in cancer cell lines from different origins." Mol Cancer Ther. 8(3):655-664. PMID:19240161
  8. [ + ] Woodward OM, et al. (2009) "Identification of a urate transporter, ABCG2, with a common functional polymorphism causing gout." Proc Natl Acad Sci U S A. 106(25):10338-10342. PMID:19506252
  9. [ + ] Guo J, et al. (2009) "Identification of genes that confer tumor cell resistance to the aurora B kinase inhibitor, AZD1152." Pharmacogenomics J. 9(2):90-102. PMID:19188929
  10. [ + ] Nakamichi N, et al. (2009) "Synergistic effect of interleukin-6 and endoplasmic reticulum stress inducers on the high level of ABCG2 expression in plasma cells." Lab Invest. 89(3):327-336. PMID:19139722
  11. [ + ] Furukawa T, et al. (2009) "Major SNP (Q141K) variant of human ABC transporter ABCG2 undergoes lysosomal and proteasomal degradations." Pharm Res. 26(2):469-479. PMID:18958403
  12. [ + ] Shukla S, et al. (2009) "Curcumin inhibits the activity of ABCG2/BCRP1, a multidrug resistance-linked ABC drug transporter in mice." Pharm Res. 26(2):480-487. PMID:18841445
  13. [ + ] Luke MM, et al. (2009) "Gene variants associated with ischemic stroke: the cardiovascular health study." Stroke. 40(2):363-368. PMID:19023099
  14. [ + ] Muller PJ, et al. (2009) "Polymorphisms in ABCG2, ABCC3 and CNT1 genes and their possible impact on chemotherapy outcome of lung cancer patients." Int J Cancer. 124(7):1669-1674. PMID:19107936
  15. [ + ] Kim DW, et al. (2009) "Lack of association between ABCB1, ABCG2, and ABCC2 genetic polymorphisms and multidrug resistance in partial epilepsy." Epilepsy Res. 84(1):86-90. PMID:19167193
  16. [ + ] Dai CL, et al. (2009) "Sensitization of ABCG2-overexpressing cells to conventional chemotherapeutic agent by sunitinib was associated with inhibiting the function of ABCG2." Cancer Lett. 279(1):74-83. PMID:19232821
  17. [ + ] Tai LM, et al. (2009) "P-glycoprotein and breast cancer resistance protein restrict apical-to-basolateral permeability of human brain endothelium to amyloid-beta." J Cereb Blood Flow Metab. 29(6):1079-1083. PMID:19367293
  18. [ + ] Kolz M, et al. (2009) "Meta-analysis of 28,141 individuals identifies common variants within five new loci that influence uric acid concentrations." PLoS Genet. 5(6):e1000504. PMID:19503597
  19. [ + ] Ota S, et al. (2009) "Immunohistochemical expression of BCRP and ERCC1 in biopsy specimen predicts survival in advanced non-small-cell lung cancer treated with cisplatin-based chemotherapy." Lung Cancer. 64(1):98-104. PMID:18823676
  20. [ + ] An R, et al. (2009) "Cellular phototoxicity evoked through the inhibition of human ABC transporter ABCG2 by cyclin-dependent kinase inhibitors in vitro." Pharm Res. 26(2):449-458. PMID:18841444
  21. [ + ] Innocenti F, et al. (2009) "Comprehensive pharmacogenetic analysis of irinotecan neutropenia and pharmacokinetics." J Clin Oncol. 27(16):2604-2614. PMID:19349540
  22. [ + ] Saito A, et al. (2009) "Association study between single-nucleotide polymorphisms in 199 drug-related genes and commonly measured quantitative traits of 752 healthy Japanese subjects." J Hum Genet. 54(6):317-323. PMID:19343046
  23. [ + ] Karla PK, et al. (2009) "Molecular expression and functional evidence of a drug efflux pump (BCRP) in human corneal epithelial cells." Curr Eye Res. 34(1):1-9. PMID:19172464
  24. [ + ] Kim DH, et al. (2009) "Genetic variants in the candidate genes of the apoptosis pathway and susceptibility to chronic myeloid leukemia." Blood. 113(11):2517-2525. PMID:19141860
  25. [ + ] Yamasaki Y, et al. (2008) "Pharmacogenetic characterization of sulfasalazine disposition based on NAT2 and ABCG2 (BCRP) gene polymorphisms in humans." Clin Pharmacol Ther. 84(1):95-103. PMID:18167504
  26. [ + ] Dehghan A, et al. (2008) "Association of three genetic loci with uric acid concentration and risk of gout: a genome-wide association study." Lancet. 372(9654):1953-1961. PMID:18834626
  27. [ + ] Raymond E, et al. (2008) "Phase II study of imatinib in patients with recurrent gliomas of various histologies: a European Organisation for Research and Treatment of Cancer Brain Tumor Group Study." J Clin Oncol. 26(28):4659-4665. PMID:18824712
  28. [ + ] Ahmed F, et al. (2008) "Constitutive expression of the ATP-binding cassette transporter ABCG2 enhances the growth potential of early human hematopoietic progenitors." Stem Cells. 26(3):810-818. PMID:18055445
  29. [ + ] Poonkuzhali B, et al. (2008) "Association of breast cancer resistance protein/ABCG2 phenotypes and novel promoter and intron 1 single nucleotide polymorphisms." Drug Metab Dispos. 36(4):780-795. PMID:18180275
  30. [ + ] Dai CL, et al. (2008) "Lapatinib (Tykerb, GW572016) reverses multidrug resistance in cancer cells by inhibiting the activity of ATP-binding cassette subfamily B member 1 and G member 2." Cancer Res. 68(19):7905-7914. PMID:18829547
  31. [ + ] Fedasenka UU, et al. (2008) "Expression of MDR1, LRP, BCRP and Bcl-2 genes at diagnosis of childhood all: comparison with MRD status after induction therapy." Exp Oncol. 30(3):248-252. PMID:18806751
  32. [ + ] Apati A, et al. (2008) "High level functional expression of the ABCG2 multidrug transporter in undifferentiated human embryonic stem cells." Biochim Biophys Acta. 1778(12):2700-2709. PMID:18793608
  33. [ + ] Hu C, et al. (2008) "Analysis of ABCG2 expression and side population identifies intrinsic drug efflux in the HCC cell line MHCC-97L and its modulation by Akt signaling." Carcinogenesis. 29(12):2289-2297. PMID:18820285
  34. [ + ] Liu F, et al. (2008) "Co-expression of cytokeratin 8 and breast cancer resistant protein indicates a multifactorial drug-resistant phenotype in human breast cancer cell line." Life Sci. 83(13-14):496-501. PMID:18725232
  35. [ + ] Velamakanni S, et al. (2008) "A functional steroid-binding element in an ATP-binding cassette multidrug transporter." Mol Pharmacol. 73(1):12-17. PMID:18094074
  36. [ + ] Xie Y, et al. (2008) "The 44-kDa Pim-1 kinase phosphorylates BCRP/ABCG2 and thereby promotes its multimerization and drug-resistant activity in human prostate cancer cells." J Biol Chem. 283(6):3349-3356. PMID:18056989
  37. [ + ] de Figueiredo-Pontes LL, et al. (2008) "Determination of P-glycoprotein, MDR-related protein 1, breast cancer resistance protein, and lung-resistance protein expression in leukemic stem cells of acute myeloid leukemia." Cytometry B Clin Cytom. 74(3):163-168. PMID:18200595
  38. [ + ] Campa D, et al. (2008) "A gene-wide investigation on polymorphisms in the ABCG2/BRCP transporter and susceptibility to colorectal cancer." Mutat Res. 645(1-2):56-60. PMID:18775442
  39. [ + ] Cusatis G, et al. (2008) "Pharmacogenomic importance of ABCG2." Pharmacogenomics. 9(8):1005-1009. PMID:18681776
  40. [ + ] Shiffman D, et al. (2008) "Association of gene variants with incident myocardial infarction in the Cardiovascular Health Study." Arterioscler Thromb Vasc Biol. 28(1):173-179. PMID:17975119
  41. [ + ] Hirayama C, et al. (2008) "Constitutive overexpression of P-glycoprotein, rather than breast cancer resistance protein or organic cation transporter 1, contributes to acquisition of imatinib-resistance in K562 cells." Pharm Res. 25(4):827-835. PMID:17934801
  42. [ + ] Ozvegy-Laczka C, et al. (2008) "Interaction with the 5D3 monoclonal antibody is regulated by intramolecular rearrangements but not by covalent dimer formation of the human ABCG2 multidrug transporter." J Biol Chem. 283(38):26059-26070. PMID:18644784
  43. [ + ] Erdilyi DJ, et al. (2008) "Synergistic interaction of ABCB1 and ABCG2 polymorphisms predicts the prevalence of toxic encephalopathy during anticancer chemotherapy." Pharmacogenomics J. 8(5):321-327. PMID:17938643
  44. [ + ] Koshiba S, et al. (2008) "Human ABC transporters ABCG2 (BCRP) and ABCG4." Xenobiotica. 38(7-8):863-888. PMID:18668433
  45. [ + ] Miura M, et al. (2008) "Influence of Drug Transporters and UGT Polymorphisms on Pharmacokinetics of Phenolic glucuronide Metabolite of Mycophenolic Acid in Japanese Renal Transplant Recipients." Ther Drug Monit. ():. PMID:18695635
  46. [ + ] Hiwase DK, et al. (2008) "Dasatinib cellular uptake and efflux in chronic myeloid leukemia cells: therapeutic implications." Clin Cancer Res. 14(12):3881-3888. PMID:18559609
  47. [ + ] Gedeon C, et al. (2008) "Breast cancer resistance protein: mediating the trans-placental transfer of glyburide across the human placenta." Placenta. 29(1):39-43. PMID:17923155
  48. [ + ] To KK, et al. (2008) "Regulation of ABCG2 expression at the 3' untranslated region of its mRNA through modulation of transcript stability and protein translation by a putative microRNA in the S1 colon cancer cell line." Mol Cell Biol. 28(17):5147-5161. PMID:18573883