ABCC12 | GeneID:94160 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 94160 Official Symbol ABCC12
Locus N/A Gene Type protein-coding
Synonyms MGC27071; MRP9
Full Name ATP-binding cassette, sub-family C (CFTR/MRP), member 12
Description ATP-binding cassette, sub-family C (CFTR/MRP), member 12
Chromosome 16q12.1
Also Known As ATP-binding cassette protein C12; ATP-binding cassette transporter sub-family C member 12; OTTHUMP00000164186; multidrug resistance-associated protein 9
Summary This gene is a member of the superfamily of ATP-binding cassette (ABC) transporters and the encoded protein contains two ATP-binding domains and 12 transmembrane regions. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies: ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White. This gene is a member of the MRP subfamily which is involved in multi-drug resistance. This gene and another subfamily member are arranged head-to-tail on chromosome 16q12.1. Increased expression of this gene is associated with breast cancer. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 57211

ID Symbol Protein Species
GeneID:94160 ABCC12 NP_150229.2 Homo sapiens
GeneID:244562 Abcc12 NP_766500.3 Mus musculus
GeneID:291923 Abcc12 NP_955409.1 Rattus norvegicus
GeneID:487294 ABCC12 XP_544420.2 Canis lupus familiaris
GeneID:568482 LOC568482 XP_696904.3 Danio rerio
GeneID:745745 ABCC12 XP_001163361.1 Pan troglodytes

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 scbt ABCC12 ABCC12 Antibody / ABCC12 Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of ABCC12 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ABCC12 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0016887 Function ATPase activity
GO:0042626 Function ATPase activity, coupled to transmembrane movement of substances
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_033226  UCSC Browser NP_150229

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000311303 MI0000267 hsa-miR-10b* ACAGAUUCGAUUCUAGGGGAAU
ENST00000311303 MI0000279 hsa-miR-196a* CGGCAACAAGAAACUGCCUGAG
ENST00000311303 MI0000239 hsa-miR-197 UUCACCACCUUCUCCACCCAGC
ENST00000311303 MI0005529 hsa-miR-220b CCACCACCGUGUCUGACACUU
ENST00000311303 MI0000744 hsa-miR-299-5p UGGUUUACCGUCCCACAUACAU
ENST00000311303 MI0000088 hsa-miR-30a* CUUUCAGUCGGAUGUUUGCAGC
ENST00000311303 MI0000255 hsa-miR-30d* CUUUCAGUCAGAUGUUUGCUGC
ENST00000311303 MI0000814 hsa-miR-338-3p UCCAGCAUCAGUGAUUUUGUUG
ENST00000311303 MI0000814 hsa-miR-338-5p AACAAUAUCCUGGUGCUGAGUG
ENST00000311303 MI0000826 hsa-miR-346 UGUCUGCCCGCAUGCCUGCCUCU
ENST00000311303 MI0000743 hsa-miR-34c-5p AGGCAGUGUAGUUAGCUGAUUGC
ENST00000311303 MI0000788 hsa-miR-380 UAUGUAAUAUGGUCCACAUCUU
ENST00000311303 MI0001445 hsa-miR-423-5p UGAGGGGCAGAGAGCGAGACUUU
ENST00000311303 MI0003125 hsa-miR-490-3p CAACCUGGAGGACUCCAUGCUG
ENST00000311303 MI0003126 hsa-miR-491-5p AGUGGGGAACCCUUCCAUGAGG
ENST00000311303 MI0003679 hsa-miR-549 UGACAACUAUGGAUGAGCUCU
ENST00000311303 MI0003562 hsa-miR-556-3p AUAUUACCAUUAGCUCAUCUUU
ENST00000311303 MI0003621 hsa-miR-608 AGGGGUGGUGUUGGGACAGCUCCGU
ENST00000311303 MI0003760 hsa-miR-671-3p UCCGGUUCUCAGGGCUCCACC
ENST00000311303 MI0005560 hsa-miR-885-3p AGGCAGCGGGGUGUAGUGGAUA
ENST00000311303 MI0002400 mmu-miR-465a-3p GAUCAGGGCCUUUCUAAGUAGA
ENST00000311303 MI0005473 mmu-miR-880 UACUCCAUCCUCUCUGAGUAGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Kimura K, et al. (2006) "Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes." Genome Res. 16(1):55-65. PMID:16344560
  2. [ + ] Haimeur A, et al. (2004) "The MRP-related and BCRP/ABCG2 multidrug resistance proteins: biology, substrate specificity and regulation." Curr Drug Metab. 5(1):21-53. PMID:14965249
  3. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  4. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  5. [ + ] Bera TK, et al. (2002) "MRP9, an unusual truncated member of the ABC transporter superfamily, is highly expressed in breast cancer." Proc Natl Acad Sci U S A. 99(10):6997-7002. PMID:12011458
  6. [ + ] Dean M, et al. (2001) "The human ATP-binding cassette (ABC) transporter superfamily." Genome Res. 11(7):1156-1166. PMID:11435397
  7. [ + ] Yabuuchi H, et al. (2001) "Multiple splicing variants of two new human ATP-binding cassette transporters, ABCC11 and ABCC12." Biochem Biophys Res Commun. 288(4):933-939. PMID:11688999
  8. [ + ] Tammur J, et al. (2001) "Two new genes from the human ATP-binding cassette transporter superfamily, ABCC11 and ABCC12, tandemly duplicated on chromosome 16q12." Gene. 273(1):89-96. PMID:11483364