ACCN3 | GeneID:9311 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 9311 Official Symbol ACCN3
Locus N/A Gene Type protein-coding
Synonyms ASIC3; DRASIC; SLNAC1; TNaC1
Full Name amiloride-sensitive cation channel 3
Description amiloride-sensitive cation channel 3
Chromosome 7q35
Also Known As amiloride-sensitive cation channel 3, testis; modulatory subunit of ASIC2a; proton-gated cation channel subunit; testis sodium channel 1
Summary This gene encodes a member of the degenerin/epithelial sodium channel (DEG/ENaC) superfamily. The members of this family are amiloride-sensitive sodium channels that contain intracellular N and C termini, two hydrophobic transmembrane regions, and a large extracellular loop, which has many cysteine residues with conserved spacing. The member encoded by this gene is an acid sensor and may play an important role in the detection of lasting pH changes. In addition, a heteromeric association between this member and ACCN1 has been observed as proton-gated channels sensitive to gadolinium. Alternative splicing of this gene generates three transcript variants encoding distinct isoforms. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 20999

ID Symbol Protein Species
GeneID:9311 ACCN3 NP_004760.1 Homo sapiens
GeneID:286920 Accn3 NP_775158.1 Rattus norvegicus
GeneID:482801 ACCN3 XP_539917.2 Canis lupus familiaris
GeneID:789132 ACCN3 XP_001255978.1 Bos taurus

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab65697 ASIC3 antibody (ab65697); Rabbit polyclonal to ASIC3
2 abcam ab49333 ASIC3 antibody (ab49333); Rabbit polyclonal to ASIC3
3 abcam ab10354 ASIC3 antibody (ab10354); Guinea pig polyclonal to ASIC3
4 scbt ACCN3 ACCN3 Antibody / ACCN3 Antibodies;
5 sigma S5070 Anti-Sodium Channel ASIC3 antibody produced in rabbit ;

Exon, Intron and UTRs

Exon, Intron and UTRs of ACCN3 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ACCN3 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0005887 Component integral to plasma membrane
GO:0005886 Component plasma membrane
GO:0015280 Function amiloride-sensitive sodium channel activity
GO:0031402 Function sodium ion binding
GO:0006811 Process ion transport
GO:0007600 Process sensory perception
GO:0007165 Process signal transduction
GO:0006814 Process sodium ion transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_004769  UCSC Browser NP_004760
2 NM_020321  UCSC Browser NP_064717
3 NM_020322  UCSC Browser NP_064718 B2R9V0   Q9UHC3  

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000297512 MI0000481 hsa-miR-184 UGGACGGAGAACUGAUAAGGGU
ENST00000297512 MI0005570 hsa-miR-208b AUAAGACGAACAAAAGGUUUGU
ENST00000297512 MI0000812 hsa-miR-331-5p CUAGGUAUGGUCCCAGGGAUCC
ENST00000297512 MI0000091 hsa-miR-33a GUGCAUUGUAGUUGCAUUGCA
ENST00000297512 MI0003646 hsa-miR-33b GUGCAUUGCUGUUGCAUUGC
ENST00000297512 MI0002467 hsa-miR-483-5p AAGACGGGAGGAAAGAAGGGAG
ENST00000297512 MI0003594 hsa-miR-586 UAUGCAUUGUAUUUUUAGGUCC
ENST00000297512 MI0003621 hsa-miR-608 AGGGGUGGUGUUGGGACAGCUCCGU
ENST00000297512 MI0005507 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENST00000297512 MI0005508 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENST00000297512 MI0005509 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENST00000297512 MI0004658 mmu-miR-690 AAAGGCUAGGCUCACAACCAAA
ENST00000349064 MI0000481 hsa-miR-184 UGGACGGAGAACUGAUAAGGGU
ENST00000349064 MI0003137 hsa-miR-193b* CGGGGUUUUGAGGGCGAGAUGA
ENST00000349064 MI0005570 hsa-miR-208b AUAAGACGAACAAAAGGUUUGU
ENST00000349064 MI0000079 hsa-miR-23a* GGGGUUCCUGGGGAUGGGAUUU
ENST00000349064 MI0000439 hsa-miR-23b* UGGGUUCCUGGCAUGCUGAUUU
ENST00000349064 MI0000812 hsa-miR-331-5p CUAGGUAUGGUCCCAGGGAUCC
ENST00000349064 MI0000091 hsa-miR-33a GUGCAUUGUAGUUGCAUUGCA
ENST00000349064 MI0003646 hsa-miR-33b GUGCAUUGCUGUUGCAUUGC
ENST00000349064 MI0002467 hsa-miR-483-5p AAGACGGGAGGAAAGAAGGGAG
ENST00000349064 MI0003594 hsa-miR-586 UAUGCAUUGUAUUUUUAGGUCC
ENST00000349064 MI0003615 hsa-miR-602 GACACGGGCGACAGCUGCGGCCC
ENST00000349064 MI0003621 hsa-miR-608 AGGGGUGGUGUUGGGACAGCUCCGU
ENST00000349064 MI0003624 hsa-miR-611 GCGAGGACCCCUCGGGGUCUGAC
ENST00000349064 MI0003672 hsa-miR-663 AGGCGGGGCGCCGCGGGACCGC
ENST00000349064 MI0005559 hsa-miR-744 UGCGGGGCUAGGGCUAACAGCA
ENST00000349064 MI0005507 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENST00000349064 MI0005508 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENST00000349064 MI0005509 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENST00000349064 MI0005510 mmu-miR-466g AUACAGACACAUGCACACACA
ENST00000349064 MI0004658 mmu-miR-690 AAAGGCUAGGCUCACAACCAAA
ENST00000357922 MI0000294 hsa-miR-218-1* AUGGUUCCGUCAAGCACCAUGG
ENST00000357922 MI0000295 hsa-miR-218-2* CAUGGUUCUGUCAAGCACCGCG
ENST00000357922 MI0000300 hsa-miR-223 UGUCAGUUUGUCAAAUACCCCA
ENST00000357922 MI0001448 hsa-miR-425* AUCGGGAAUGUCGUGUCCGCCC
ENST00000357922 MI0002467 hsa-miR-483-3p UCACUCCUCUCCUCCCGUCUU
ENST00000357922 MI0003142 hsa-miR-498 UUUCAAGCCAGGGGGCGUUUUUC
ENST00000357922 MI0003515 hsa-miR-544 AUUCUGCAUUUUUAGCAAGUUC
ENST00000357922 MI0003631 hsa-miR-617 AGACUUCCCAUUUGAAGGUGGC
ENST00000357922 MI0005494 mmu-miR-343 UCUCCCUUCAUGUGCCCAGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Acetaminophen
  • Acetaminophen affects the expression of ACCN3 mRNA
17562736
Carbon Tetrachloride
  • Carbon Tetrachloride results in decreased expression of ACCN3 mRNA
17805973
tetramethylpyrazine
  • tetramethylpyrazine results in increased expression of ACCN3 mRNA
15520497

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Carbon Tetrachloride Poisoning inferred via Carbon Tetrachloride 16192424, 15673190, 10355542, 16011737, 16097048, 16050911, 15700767, 16124888, 16227642
Fatty Liver inferred via Carbon Tetrachloride 16045604, 17595544, 16239168, 15959796, 12795759, 61145, 12631006
Hepatitis, Toxic inferred via Carbon Tetrachloride 17522070, 16177239, 15998439, 15027814, 15968718, 16227642, 11566570
Hyperbilirubinemia inferred via Carbon Tetrachloride 16899240
Liver Cirrhosis inferred via Carbon Tetrachloride 17174718, 16221502, 16239168, 17334410, 16943688
Liver Cirrhosis, Experimental inferred via Carbon Tetrachloride 16192424, 16116963, 17525996, 17557913, 18156304, 16638106, 18418968, 17721639, 18277467, 18205269, 14716496, 15730626, 12632514, 15052691, 12632512, 17766677, 17708605, 12667390, 14748882, 13678700, 15818738, 17631135, 16097048, 15673190, 12649538, 12445421, 12445418, 15959796, 12898905, 18317297, 17761835, 14620537, 18472332, 14716833, 16015684, 12741479, 14724832, 18472094, 15931870, 17698563, 15893842, 12958196, 17640975, 18376398, 12389079, 18187930, 18210741, 18412020, 17714472, 14512876, 12609069, 18166357, 17922224, 18420326, 15876570, 16136751, 17481882, 17900296, 15123356, 18339082, 18429990, 12546737, 18006644, 18481824, 15057751, 12586293, 18054572, 10355542, 16011737, 18251166, 17823541, 17944888, 18395914, 18279442, 16027843, 15996030, 16033810, 17565644, 17869086, 12666154, 18395095, 17976157, 17805973, 16248980, 15925388
Liver Diseases inferred via Carbon Tetrachloride 16246199, 15720792, 16964402, 17285989, 15830285
Liver Failure inferred via Carbon Tetrachloride 15123358
Liver Failure, Acute inferred via Carbon Tetrachloride 14706259, 16899240
Liver Neoplasms, Experimental inferred via Carbon Tetrachloride 15583823
Hepatitis, Toxic inferred via Acetaminophen 2444490, 16081117, 17522070, 17562736, 14986274, 16177239, 16227642, 15968718
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
ACCN1 ACCN1 / ACCN3 Affinity Capture-Western Babinski K (2000)
DLG4 ACCN3 / DLG4 Affinity Capture-Western Hruska-Hageman AM (2004)
GOPC ACCN3 / GOPC Affinity Capture-Western Hruska-Hageman AM (2004)
GOPC ACCN3 / GOPC Two-hybrid Hruska-Hageman AM (2004)
INADL ACCN3 / INADL Invitro Anzai N (2002)
INADL ACCN3 / INADL Two-hybrid Anzai N (2002)
LIN7B ACCN3 / LIN7B Affinity Capture-Western Hruska-Hageman AM (2004)
LIN7B ACCN3 / LIN7B Two-hybrid Hruska-Hageman AM (2004)
MAGI1 ACCN3 / MAGI1 Affinity Capture-Western Hruska-Hageman AM (2004)
MAGI1 ACCN3 / MAGI1 Two-hybrid Hruska-Hageman AM (2004)
PRKACA PRKACA / ACCN3 Biochemical Activity Leonard AS (2003)
STOML1 STOML1 / ACCN3 Affinity Capture-Western Price MP (2004)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Ko YL, et al. (2008) "Genetic variation in the ASIC3 gene influences blood pressure levels in Taiwanese." J Hypertens. 26(11):2154-2160. PMID:18854755
  2. [ + ] Su X, et al. (2006) "Interregulation of proton-gated Na(+) channel 3 and cystic fibrosis transmembrane conductance regulator." J Biol Chem. 281(48):36960-36968. PMID:17012229
  3. [ + ] Hruska-Hageman AM, et al. (2004) "PSD-95 and Lin-7b interact with acid-sensing ion channel-3 and have opposite effects on H+- gated current." J Biol Chem. 279(45):46962-46968. PMID:15317815
  4. [ + ] Jones NG, et al. (2004) "Acid-induced pain and its modulation in humans." J Neurosci. 24(48):10974-10979. PMID:15574747
  5. [ + ] Price MP, et al. (2004) "Stomatin modulates gating of acid-sensing ion channels." J Biol Chem. 279(51):53886-53891. PMID:15471860
  6. [ + ] Scherer SW, et al. (2003) "Human chromosome 7: DNA sequence and biology." Science. 300(5620):767-772. PMID:12690205
  7. [ + ] Leonard AS, et al. (2003) "cAMP-dependent protein kinase phosphorylation of the acid-sensing ion channel-1 regulates its binding to the protein interacting with C-kinase-1." Proc Natl Acad Sci U S A. 100(4):2029-2034. PMID:12578970
  8. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  9. [ + ] Alvarez de la Rosa D, et al. (2002) "Functional implications of the localization and activity of acid-sensitive channels in rat peripheral nervous system." Proc Natl Acad Sci U S A. 99(4):2326-2331. PMID:11842212
  10. [ + ] Anzai N, et al. (2002) "The multivalent PDZ domain-containing protein CIPP is a partner of acid-sensing ion channel 3 in sensory neurons." J Biol Chem. 277(19):16655-16661. PMID:11872753
  11. [ + ] Chen CC, et al. (2002) "A role for ASIC3 in the modulation of high-intensity pain stimuli." Proc Natl Acad Sci U S A. 99(13):8992-8997. PMID:12060708
  12. [ + ] Catarsi S, et al. (2001) "Selective modulation of heteromeric ASIC proton-gated channels by neuropeptide FF." Neuropharmacology. 41(5):592-600. PMID:11587714
  13. [ + ] Babinski K, et al. (2000) "Mammalian ASIC2a and ASIC3 subunits co-assemble into heteromeric proton-gated channels sensitive to Gd3+." J Biol Chem. 275(37):28519-28525. PMID:10842183
  14. [ + ] Babinski K, et al. (1999) "Molecular cloning and regional distribution of a human proton receptor subunit with biphasic functional properties." J Neurochem. 72(1):51-57. PMID:9886053
  15. [ + ] Ishibashi K, et al. (1998) "Molecular cloning of a DEG/ENaC sodium channel cDNA from human testis." Biochem Biophys Res Commun. 245(2):589-593. PMID:9571199
  16. [ + ] de Weille JR, et al. (1998) "Identification, functional expression and chromosomal localisation of a sustained human proton-gated cation channel." FEBS Lett. 433(3):257-260. PMID:9744806