ACBD5 | GeneID:91452 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 91452 Official Symbol ACBD5
Locus N/A Gene Type protein-coding
Synonyms DKFZp434A2417; KIAA1996
Full Name acyl-Coenzyme A binding domain containing 5
Description acyl-Coenzyme A binding domain containing 5
Chromosome 10p12.1
Also Known As OTTHUMP00000019363; endozepine-related protein; membrane-associated diazepam binding inhibitor
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 12541

ID Symbol Protein Species
GeneID:74159 Acbd5 NP_083069.1 Mus musculus
GeneID:91452 ACBD5 NP_001035938.1 Homo sapiens
GeneID:307170 Acbd5 XP_225630.4 Rattus norvegicus
GeneID:353160 ACBD5 NP_851381.1 Bos taurus
GeneID:420488 ACBD5 NP_001006356.1 Gallus gallus
GeneID:450368 ACBD5 XP_507712.2 Pan troglodytes
GeneID:477987 ACBD5 XP_848880.1 Canis lupus familiaris
GeneID:553674 zgc:112043 NP_001018483.1 Danio rerio
GeneID:679565 LOC679565 XP_001053520.1 Rattus norvegicus

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 sigma HPA012145 Anti-ACBD5 antibody produced in rabbit ;
2 sigma HPA011861 Anti-ACBD5 antibody produced in rabbit ;

Exon, Intron and UTRs

Exon, Intron and UTRs of ACBD5 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ACBD5 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0000062 Function acyl-CoA binding
GO:0008289 Function lipid binding
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001042473  UCSC Browser NP_001035938
2 NM_145698  UCSC Browser NP_663736
3 NR_024150  UCSC Browser

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000375905 MI0003150 hsa-miR-526b CUCUUGAGGGAAGCACUUUCUGU
ENST00000375905 MI0003619 hsa-miR-606 AAACUACUGAAAAUCAAAGAU
ENST00000375905 MI0002401 mmu-miR-466a-5p UAUGUGUGUGUACAUGUACAUA
ENST00000375905 MI0005502 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENST00000375905 MI0005503 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENST00000375905 MI0005504 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENST00000375905 MI0005505 mmu-miR-466c-5p GAUGUGUGUGUGCAUGUACAUA
ENST00000375905 MI0005506 mmu-miR-466e-5p GAUGUGUGUGUACAUGUACAUA
ENST00000375905 MI0004690 mmu-miR-706 AGAGAAACCCUGUCUCAAAAAA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Acetaminophen
  • Acetaminophen affects the expression of ACBD5 mRNA
17562736
pirinixic acid
  • pirinixic acid results in increased expression of ACBD5 mRNA
18301758
Tetracycline
  • Tetracycline results in increased expression of ACBD5 mRNA
16917069

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Fatty Liver inferred via Tetracycline 16917069
Hepatitis, Toxic inferred via Tetracycline 17522070
Nephritis, Interstitial inferred via Tetracycline 9884423
Pemphigoid, Bullous inferred via Tetracycline 11026799
Prion Diseases inferred via Tetracycline 10903871
Edema inferred via pirinixic acid 12083418
Liver Neoplasms inferred via pirinixic acid 15890375
Hepatitis, Toxic inferred via Acetaminophen 2444490, 14986274, 16227642, 15968718, 16177239, 17562736, 16081117, 17522070
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  2. [ + ] Suzuki Y, et al. (2004) "Sequence comparison of human and mouse genes reveals a homologous block structure in the promoter regions." Genome Res. 14(9):1711-1718. PMID:15342556
  3. [ + ] Ohara O, et al. (2002) "Characterization of size-fractionated cDNA libraries generated by the in vitro recombination-assisted method." DNA Res. 9(2):47-57. PMID:12056414
  4. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932