ACVR1B | GeneID:91 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 91 Official Symbol ACVR1B
Locus N/A Gene Type protein-coding
Synonyms ACTRIB; ACVRLK4; ALK4; SKR2
Full Name activin A receptor, type IB
Description activin A receptor, type IB
Chromosome 12q13
Also Known As activin A receptor, type II-like kinase 4; activin receptor-like kinase 4; serine(threonine) protein kinase receptor R2
Summary Activins are dimeric growth and differentiation factors which belong to the transforming growth factor-beta (TGF-beta) superfamily of structurally related signaling proteins. Activins signal through a heteromeric complex of receptor serine kinases which include at least two type I (I and IB) and two type II (II and IIB) receptors. These receptors are all transmembrane proteins, composed of a ligand-binding extracellular domain with a cysteine-rich region, a transmembrane domain, and a cytoplasmic domain with predicted serine/threonine specificity. Type I receptors are essential for signaling, and type II receptors are required for binding ligands and for expression of type I receptors. Type I and II receptors form a stable complex after ligand binding, resulting in phosphorylation of type I receptors by type II receptors. This gene encodes activin A type IB receptor, composed of 11 exons. Alternative splicing and alternative polyadenylation result in 3 fully described transcript variants. The mRNA expression of variants 1, 2, and 3 is confirmed, and a potential fourth variant contains an alternative exon 8 and lacks exons 9 through 11, but its mRNA expression has not been confirmed. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 20906

ID Symbol Protein Species
GeneID:91 ACVR1B NP_004293.1 Homo sapiens
GeneID:11479 Acvr1b NP_031421.1 Mus musculus
GeneID:29381 Acvr1b NP_954700.1 Rattus norvegicus
GeneID:30183 acvr1b NP_571065.1 Danio rerio
GeneID:451911 ACVR1B XP_001145219.1 Pan troglodytes
GeneID:486537 ACVR1B XP_543663.2 Canis lupus familiaris
GeneID:539315 ACVR1B XP_586402.3 Bos taurus
GeneID:559222 LOC559222 XP_687633.2 Danio rerio
GeneID:768878 ACVR1B XP_001231301.1 Gallus gallus

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab37813 Activin A Receptor Type IB antibody (ab37813); Rabbit polyclonal to Activin A Receptor Type IB
2 abcam ab54953 Activin A Receptor Type IB antibody (ab54953); Mouse monoclonal to Activin A Receptor Type IB
3 abcam ab64813 Activin A Receptor Type IB antibody (ab64813); Rabbit polyclonal to Activin A Receptor Type IB
4 abcam ab10594 Activin A Receptor Type IB antibody (ab10594); Goat polyclonal to Activin A Receptor Type IB
5 abgent AP7801a ACVR1B Antibody (N-term); Purified Rabbit Polyclonal Antibody (Pab)
6 abgent AP7801b ACVR1B Antibody (Center I149); Purified Rabbit Polyclonal Antibody (Pab)
7 abgent AP7801c ACVR1B Antibody (Center); Purified Rabbit Polyclonal Antibody (Pab)
8 abnova H00000091-M08 ACVR1B monoclonal antibody (M08), clone 6G11; Mouse monoclonal antibody raised against a partial recombinant ACVR1B.
9 abnova H00000091-M06 ACVR1B monoclonal antibody (M06), clone 2E12; Mouse monoclonal antibody raised against a partial recombinant ACVR1B.
10 abnova H00000091-M02 ACVR1B monoclonal antibody (M02), clone 6D3; Mouse monoclonal antibody raised against a partial recombinant ACVR1B.
11 abnova H00000091-M01 ACVR1B monoclonal antibody (M01), clone 2D4; Mouse monoclonal antibody raised against a partial recombinant ACVR1B.
12 abnova H00000091-M09 ACVR1B monoclonal antibody (M09), clone 1C1; Mouse monoclonal antibody raised against a partial recombinant ACVR1B.
13 acris AP14598PU-N Activin receptor type 1B (ACVR1B) (Center); antibody Ab
14 acris AP14597PU-N Activin receptor type 1B (ACVR1B) (Center); antibody Ab
15 acris AP14596PU-N Activin receptor type 1B (ACVR1B) (N-term); antibody Ab
16 acris AP06686PU-N Activin receptor type 1B (ACVR1B); antibody Ab
17 scbt ACVR1B ACVR1B Antibody / ACVR1B Antibodies;
18 sigma A2455 Anti-Activin Receptor IB antibody produced in goat ;

Exon, Intron and UTRs

Exon, Intron and UTRs of ACVR1B Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ACVR1B Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0009986 Component cell surface
GO:0005887 Component integral to plasma membrane
GO:0016020 Component membrane
GO:0048185 Function activin binding
GO:0016361 Function activin receptor activity, type I
GO:0005524 Function ATP binding
GO:0019838 Function growth factor binding
GO:0000287 Function magnesium ion binding
GO:0030145 Function manganese ion binding
GO:0000166 Function nucleotide binding
GO:0004674 Function protein serine/threonine kinase activity
GO:0004872 Function receptor activity
GO:0046332 Function SMAD binding
GO:0016740 Function transferase activity
GO:0043130 Function ubiquitin binding
GO:0031625 Function ubiquitin protein ligase binding
GO:0009790 Process embryonic development
GO:0000082 Process G1/S transition of mitotic cell cycle
GO:0001942 Process hair follicle development
GO:0006917 Process induction of apoptosis
GO:0001701 Process in utero embryonic development
GO:0030308 Process negative regulation of cell growth
GO:0018107 Process peptidyl-threonine phosphorylation
GO:0032927 Process positive regulation of activin receptor signaling pathway
GO:0045648 Process positive regulation of erythrocyte differentiation
GO:0046777 Process protein amino acid autophosphorylation
GO:0045449 Process regulation of transcription
GO:0007165 Process signal transduction
GO:0007178 Process transmembrane receptor protein serine/threonine kinase signaling pathway

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_004302  UCSC Browser NP_004293
2 NM_020327  UCSC Browser NP_064732
3 NM_020328  UCSC Browser NP_064733

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000257963 MI0005512 mmu-miR-467c UAAGUGCGUGCAUGUAUAUGUG
ENST00000257963 MI0005513 mmu-miR-467d UAAGUGCGCGCAUGUAUAUGCG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

[ - ] Somatic Mutations in Cancer - Sanger's COSMIC

The mutation data was obtained from the Sanger Institute Catalogue Of Somatic Mutations In Cancer web site, http://www.sanger.ac.uk/cosmic Bamford et al (2004) The COSMIC (Catalogue of Somatic Mutations in Cancer) database and website. Br J Cancer, 91,355-358.
Mutation (top 10)Total Observations
c.1159_1163delGATGA2
c.?del?2
c.1377T>C1
Primary Site / Histology (Top 10)Mutations (sites * observations)
pancreas / carcinoma4
kidney / carcinoma1

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Dust
  • Dust results in decreased expression of ACVR1B mRNA
17805423

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
ACVR1 ACVR1B / ACVR1 Affinity Capture-Western De Winter JP (1996)
ACVR2A ACVR1B / ACVR2A Affinity Capture-Western De Winter JP (1996)
ACVR2A ACVR1B / ACVR2A Affinity Capture-Western Lebrun JJ (1999)
ACVR2B ACVR2B / ACVR1B Affinity Capture-Western De Winter JP (1996)
ACVR2B ACVR2B / ACVR1B Co-purification Attisano L (1996)
BMPR2 BMPR2 / ACVR1B Two-hybrid Liu F (1995)
INHBA INHBA / ACVR1B Affinity Capture-Western Martens JW (1997)
INHBB INHBB / ACVR1B Affinity Capture-Western Martens JW (1997)
SMAD2 ACVR1B / SMAD2 Affinity Capture-Western Lebrun JJ (1999)
SMAD3 ACVR1B / SMAD3 Affinity Capture-Western Lebrun JJ (1999)
Smad7 Smad7 / ACVR1B Affinity Capture-Western Souchelnytskyi S (1998)
SMAD7 ACVR1B / SMAD7 Affinity Capture-Western Liu X (2002)
SNX1 SNX1 / ACVR1B Affinity Capture-Western Parks WT (2001)
SNX2 SNX2 / ACVR1B Affinity Capture-Western Parks WT (2001)
TDGF1 TDGF1 / ACVR1B Reconstituted Complex Bianco C (2002)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Calvanese L, et al. (2009) "Structural insights into the interaction between the Cripto CFC domain and the ALK4 receptor." J Pept Sci. 15(3):175-183. PMID:19035567
  2. [ + ] Wang Q, et al. (2008) "MicroRNA miR-24 inhibits erythropoiesis by targeting activin type I receptor ALK4." Blood. 111(2):588-595. PMID:17906079
  3. [ + ] Esguerra CV, et al. (2007) "Ttrap is an essential modulator of Smad3-dependent Nodal signaling during zebrafish gastrulation and left-right axis determination." Development. 134(24):4381-4393. PMID:18039968
  4. [ + ] Yamaguchi T, et al. (2006) "FKBP12 functions as an adaptor of the Smad7-Smurf1 complex on activin type I receptor." J Mol Endocrinol. 36(3):569-579. PMID:16720724
  5. [ + ] Tsuchida K, et al. (2004) "Activin isoforms signal through type I receptor serine/threonine kinase ALK7." Mol Cell Endocrinol. 220(1-2):59-65. PMID:15196700
  6. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  7. [ + ] Zhang L, et al. (2004) "Zebrafish Dpr2 inhibits mesoderm induction by promoting degradation of nodal receptors." Science. 306(5693):114-117. PMID:15459392
  8. [ + ] Harrison CA, et al. (2004) "An activin mutant with disrupted ALK4 binding blocks signaling via type II receptors." J Biol Chem. 279(27):28036-28044. PMID:15123686
  9. [ + ] Casagrandi D, et al. (2003) "Inhibin, activin, follistatin, activin receptors and beta-glycan gene expression in the placental tissue of patients with pre-eclampsia." Mol Hum Reprod. 9(4):199-203. PMID:12651901
  10. [ + ] Rebbapragada A, et al. (2003) "Myostatin signals through a transforming growth factor beta-like signaling pathway to block adipogenesis." Mol Cell Biol. 23(20):7230-7242. PMID:14517293
  11. [ + ] Harrison CA, et al. (2003) "Identification of a functional binding site for activin on the type I receptor ALK4." J Biol Chem. 278(23):21129-21135. PMID:12665502
  12. [ + ] Mukasa C, et al. (2003) "Activin signaling through type IB activin receptor stimulates aromatase activity in the ovarian granulosa cell-like human granulosa (KGN) cells." Endocrinology. 144(4):1603-1611. PMID:12639945
  13. [ + ] Bianco C, et al. (2002) "Cripto-1 activates nodal- and ALK4-dependent and -independent signaling pathways in mammary epithelial Cells." Mol Cell Biol. 22(8):2586-2597. PMID:11909953
  14. [ + ] Schneider-Kolsky ME, et al. (2002) "The distribution of activin and activin receptors in gestational tissues across human pregnancy and during labour." Placenta. 23(4):294-302. PMID:11969340
  15. [ + ] Liu X, et al. (2002) "Phosphorylation regulation of the interaction between Smad7 and activin type I receptor." FEBS Lett. 519(1-3):93-98. PMID:12023024
  16. [ + ] Welt CK, et al. (2002) "The physiology and pathophysiology of inhibin, activin and follistatin in female reproduction." Curr Opin Obstet Gynecol. 14(3):317-323. PMID:12032389
  17. [ + ] Inman GJ, et al. (2002) "SB-431542 is a potent and specific inhibitor of transforming growth factor-beta superfamily type I activin receptor-like kinase (ALK) receptors ALK4, ALK5, and ALK7." Mol Pharmacol. 62(1):65-74. PMID:12065756
  18. [ + ] Maguire PB, et al. (2002) "Identification of the phosphotyrosine proteome from thrombin activated platelets." Proteomics. 2(6):642-648. PMID:12112843
  19. [ + ] Danila DC, et al. (2002) "Overexpression of wild-type activin receptor alk4-1 restores activin antiproliferative effects in human pituitary tumor cells." J Clin Endocrinol Metab. 87(10):4741-4746. PMID:12364468
  20. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  21. [ + ] Chapman SC, et al. (2001) "Modulation of activin signal transduction by inhibin B and inhibin-binding protein (INhBP)." Mol Endocrinol. 15(4):668-679. PMID:11266516
  22. [ + ] Su GH, et al. (2001) "ACVR1B (ALK4, activin receptor type 1B) gene mutations in pancreatic carcinoma." Proc Natl Acad Sci U S A. 98(6):3254-3257. PMID:11248065
  23. [ + ] Birkey Reffey S, et al. (2001) "X-linked inhibitor of apoptosis protein functions as a cofactor in transforming growth factor-beta signaling." J Biol Chem. 276(28):26542-26549. PMID:11356828
  24. [ + ] Parks WT, et al. (2001) "Sorting nexin 6, a novel SNX, interacts with the transforming growth factor-beta family of receptor serine-threonine kinases." J Biol Chem. 276(22):19332-19339. PMID:11279102
  25. [ + ] Wurthner JU, et al. (2001) "Transforming growth factor-beta receptor-associated protein 1 is a Smad4 chaperone." J Biol Chem. 276(22):19495-19502. PMID:11278302
  26. [ + ] Gray PC, et al. (2000) "Identification of a binding site on the type II activin receptor for activin and inhibin." J Biol Chem. 275(5):3206-3212. PMID:10652306
  27. [ + ] Zhou Y, et al. (2000) "Truncated activin type I receptor Alk4 isoforms are dominant negative receptors inhibiting activin signaling." Mol Endocrinol. 14(12):2066-2075. PMID:11117535
  28. [ + ] Lebrun JJ, et al. (1999) "Roles of pathway-specific and inhibitory Smads in activin receptor signaling." Mol Endocrinol. 13(1):15-23. PMID:9892009
  29. [ + ] Souchelnytskyi S, et al. (1998) "Physical and functional interaction of murine and Xenopus Smad7 with bone morphogenetic protein receptors and transforming growth factor-beta receptors." J Biol Chem. 273(39):25364-25370. PMID:9738003
  30. [ + ] Hashimoto O, et al. (1998) "The role of activin type I receptors in activin A-induced growth arrest and apoptosis in mouse B-cell hybridoma cells." Cell Signal. 10(10):743-749. PMID:9884026
  31. [ + ] Roijer E, et al. (1998) "Chromosomal localization of three human genes encoding members of the TGF-beta superfamily of type I serine/threonine kinase receptors." Mamm Genome. 9(3):266-268. PMID:9501322
  32. [ + ] Martens JW, et al. (1997) "Inhibin interferes with activin signaling at the level of the activin receptor complex in Chinese hamster ovary cells." Endocrinology. 138(7):2928-2936. PMID:9202237
  33. [ + ] Lebrun JJ, et al. (1997) "Activin and inhibin have antagonistic effects on ligand-dependent heteromerization of the type I and type II activin receptors and human erythroid differentiation." Mol Cell Biol. 17(3):1682-1691. PMID:9032295
  34. [ + ] De Winter JP, et al. (1996) "Truncated activin type II receptors inhibit bioactivity by the formation of heteromeric complexes with activin type I. receptors." Exp Cell Res. 224(2):323-334. PMID:8612709
  35. [ + ] Attisano L, et al. (1996) "Activation of signalling by the activin receptor complex." Mol Cell Biol. 16(3):1066-1073. PMID:8622651
  36. [ + ] Liu F, et al. (1995) "Human type II receptor for bone morphogenic proteins (BMPs): extension of the two-kinase receptor model to the BMPs." Mol Cell Biol. 15(7):3479-3486. PMID:7791754
  37. [ + ] Xu J, et al. (1994) "Genomic structure and cloned cDNAs predict that four variants in the kinase domain of serine/threonine kinase receptors arise by alternative splicing and poly(A) addition." Proc Natl Acad Sci U S A. 91(17):7957-7961. PMID:8058741
  38. [ + ] Carcamo J, et al. (1994) "Type I receptors specify growth-inhibitory and transcriptional responses to transforming growth factor beta and activin." Mol Cell Biol. 14(6):3810-3821. PMID:8196624
  39. [ + ] ten Dijke P, et al. (1993) "Activin receptor-like kinases: a novel subclass of cell-surface receptors with predicted serine/threonine kinase activity." Oncogene. 8(10):2879-2887. PMID:8397373