ACVR1 | GeneID:90 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 90 Official Symbol ACVR1
Locus N/A Gene Type protein-coding
Synonyms ACTRI; ACVR1A; ACVRLK2; ALK2; FOP; SKR1; TSRI
Full Name activin A receptor, type I
Description activin A receptor, type I
Chromosome 2q23-q24
Also Known As TGF-B superfamily receptor type I; activin A receptor, type II-like kinase 2; hydroxyalkyl-protein kinase; serine/threonine-protein kinase receptor R1
Summary Activins are dimeric growth and differentiation factors which belong to the transforming growth factor-beta (TGF-beta) superfamily of structurally related signaling proteins. Activins signal through a heteromeric complex of receptor serine kinases which include at least two type I ( I and IB) and two type II (II and IIB) receptors. These receptors are all transmembrane proteins, composed of a ligand-binding extracellular domain with cysteine-rich region, a transmembrane domain, and a cytoplasmic domain with predicted serine/threonine specificity. Type I receptors are essential for signaling; and type II receptors are required for binding ligands and for expression of type I receptors. Type I and II receptors form a stable complex after ligand binding, resulting in phosphorylation of type I receptors by type II receptors. This gene encodes activin A type I receptor which signals a particular transcriptional response in concert with activin type II receptors. Mutations in this gene are associated with fibrodysplasia ossificans progressive. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 7

ID Symbol Protein Species
GeneID:90 ACVR1 NP_001096.1 Homo sapiens
GeneID:11477 Acvr1 NP_031420.2 Mus musculus
GeneID:30615 acvr1 NP_571420.1 Danio rerio
GeneID:35731 sax NP_523652.2 Drosophila melanogaster
GeneID:79558 Acvr1 NP_077812.1 Rattus norvegicus
GeneID:338068 ACVR1 NP_788836.1 Bos taurus
GeneID:395246 ACVR1 NP_989891.1 Gallus gallus
GeneID:470565 ACVR1 XP_001145163.1 Pan troglodytes
GeneID:478757 ACVR1 XP_856152.1 Canis lupus familiaris
GeneID:1269509 AgaP_AGAP007729 XP_308147.2 Anopheles gambiae

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab10592 Activin Receptor Type IA antibody (ab10592); Goat polyclonal to Activin Receptor Type IA
2 abcam ab66924 Activin Receptor Type IA antibody (ab66924); Goat polyclonal to Activin Receptor Type IA
3 abcam ab60157 Activin Receptor Type IA antibody (ab60157); Rabbit polyclonal to Activin Receptor Type IA
4 abcam ab60158 Activin Receptor Type IA antibody (ab60158); Rabbit polyclonal to Activin Receptor Type IA
5 abcam ab47086 Activin Receptor Type IA antibody (ab47086); Rabbit polyclonal to Activin Receptor Type IA
6 abgent AP7101b ACVR1 Antibody (N-term); Purified Rabbit Polyclonal Antibody (Pab)
7 abgent AP7101a ACVR1 Antibody (Center N153); Purified Rabbit Polyclonal Antibody (Pab)
8 abgent AP7806c ACVR1 Antibody (Center R147); Purified Rabbit Polyclonal Antibody (Pab)
9 abgent AP7101c ACVR1 Antibody (Center N99); Purified Rabbit Polyclonal Antibody (Pab)
10 acris AP08925PU-N Activin receptor type 1 (ACRV1); antibody Ab
11 acris AP13708PU-N Activin receptor type 1 (ACRV1) (Center); antibody Ab
12 acris AP14607PU-N Activin receptor type 1 (ACRV1) (Center); antibody Ab
13 acris AP08420PU-N Activin receptor type 1 (ACRV1) (aa 475-509); antibody Ab
14 acris AP13707PU-N Activin receptor type 1 (ACRV1) (N-term); antibody Ab
15 acris AP13706PU-N Activin receptor type 1 (ACRV1) (Center); antibody Ab
16 acris AP16718PU-N Activin receptor type 1 (ACRV1); antibody Ab
17 scbt ACVR1 ACVR1 Antibody / ACVR1 Antibodies;
18 sigma A2205 Anti-Activin Receptor IA antibody produced in goat ;
19 sigma HPA007505 Anti-ACVR1 antibody produced in rabbit ;

Exon, Intron and UTRs

Exon, Intron and UTRs of ACVR1 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ACVR1 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0048179 Component activin receptor complex
GO:0045177 Component apical part of cell
GO:0016020 Component membrane
GO:0048185 Function activin binding
GO:0016361 Function activin receptor activity, type I
GO:0005524 Function ATP binding
GO:0048184 Function follistatin binding
GO:0000287 Function magnesium ion binding
GO:0030145 Function manganese ion binding
GO:0000166 Function nucleotide binding
GO:0042803 Function protein homodimerization activity
GO:0004872 Function receptor activity
GO:0046332 Function SMAD binding
GO:0016740 Function transferase activity
GO:0050431 Function transforming growth factor beta binding
GO:0002526 Process acute inflammatory response
GO:0030509 Process BMP signaling pathway
GO:0007368 Process determination of left/right symmetry
GO:0009790 Process embryonic development
GO:0000082 Process G1/S transition of mitotic cell cycle
GO:0001702 Process gastrulation with mouth forming second
GO:0007281 Process germ cell development
GO:0007507 Process heart development
GO:0001701 Process in utero embryonic development
GO:0007498 Process mesoderm development
GO:0001707 Process mesoderm formation
GO:0032926 Process negative regulation of activin receptor signaling pathway
GO:0043066 Process negative regulation of apoptosis
GO:0001755 Process neural crest cell migration
GO:0001569 Process patterning of blood vessels
GO:0060037 Process pharyngeal system development
GO:0030501 Process positive regulation of bone mineralization
GO:0045669 Process positive regulation of osteoblast differentiation
GO:0045941 Process positive regulation of transcription
GO:0006468 Process protein amino acid phosphorylation
GO:0030278 Process regulation of ossification
GO:0048641 Process regulation of skeletal muscle tissue development
GO:0051145 Process smooth muscle cell differentiation
GO:0001655 Process urogenital system development

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001105  UCSC Browser NP_001096
2 NM_001111067  UCSC Browser NP_001104537

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000263640 MI0000063 hsa-let-7b* CUAUACAACCUACUGCCUUCCC
ENST00000263640 MI0000437 hsa-miR-1 UGGAAUGUAAAGAAGUAUGUAU
ENST00000263640 MI0000651 hsa-miR-1 UGGAAUGUAAAGAAGUAUGUAU
ENST00000263640 MI0000448 hsa-miR-130a CAGUGCAAUGUUAAAAGGGCAU
ENST00000263640 MI0000748 hsa-miR-130b CAGUGCAAUGAUGAAAGGGCAU
ENST00000263640 MI0000449 hsa-miR-132 UAACAGUCUACAGCCAUGGUCG
ENST00000263640 MI0000454 hsa-miR-137 UUAUUGCUUAAGAAUACGCGUAG
ENST00000263640 MI0000239 hsa-miR-197 UUCACCACCUUCUCCACCCAGC
ENST00000263640 MI0000075 hsa-miR-19b-2* AGUUUUGCAGGUUUGCAUUUCA
ENST00000263640 MI0000283 hsa-miR-203 GUGAAAUGUUUAGGACCACUAG
ENST00000263640 MI0000745 hsa-miR-301a CAGUGCAAUAGUAUUGUCAAAGC
ENST00000263640 MI0000774 hsa-miR-302d* ACUUUAACAUGGAGGCACUUGC
ENST00000263640 MI0000088 hsa-miR-30a UGUAAACAUCCUCGACUGGAAG
ENST00000263640 MI0000441 hsa-miR-30b UGUAAACAUCCUACACUCAGCU
ENST00000263640 MI0000254 hsa-miR-30c UGUAAACAUCCUACACUCUCAGC
ENST00000263640 MI0000736 hsa-miR-30c UGUAAACAUCCUACACUCUCAGC
ENST00000263640 MI0000255 hsa-miR-30d UGUAAACAUCCCCGACUGGAAG
ENST00000263640 MI0000749 hsa-miR-30e UGUAAACAUCCUUGACUGGAAG
ENST00000263640 MI0000089 hsa-miR-31* UGCUAUGCCAACAUAUUGCCAU
ENST00000263640 MI0000814 hsa-miR-338-3p UCCAGCAUCAGUGAUUUUGUUG
ENST00000263640 MI0000767 hsa-miR-365 UAAUGCCCCUAAAAAUCCUUAU
ENST00000263640 MI0000769 hsa-miR-365 UAAUGCCCCUAAAAAUCCUUAU
ENST00000263640 MI0001652 hsa-miR-450a UUUUGCGAUGUGUUCCUAAUAU
ENST00000263640 MI0003187 hsa-miR-450a UUUUGCGAUGUGUUCCUAAUAU
ENST00000263640 MI0003820 hsa-miR-454 UAGUGCAAUAUUGCUUAUAGGGU
ENST00000263640 MI0003198 hsa-miR-514 AUUGACACUUCUGUGAGUAGA
ENST00000263640 MI0003199 hsa-miR-514 AUUGACACUUCUGUGAGUAGA
ENST00000263640 MI0003200 hsa-miR-514 AUUGACACUUCUGUGAGUAGA
ENST00000263640 MI0003619 hsa-miR-606 AAACUACUGAAAAUCAAAGAU
ENST00000263640 MI0003635 hsa-miR-621 GGCUAGCAACAGCGCUUACCU
ENST00000263640 MI0005542 hsa-miR-876-5p UGGAUUUCUUUGUGAAUCACCA
ENST00000263640 MI0005758 hsa-miR-936 ACAGUAGAGGGAGGAAUCGCAG
ENST00000263640 MI0005512 mmu-miR-467c UAAGUGCGUGCAUGUAUAUGUG
ENST00000263640 MI0005513 mmu-miR-467d UAAGUGCGCGCAUGUAUAUGCG
ENST00000263640 MI0004523 mmu-miR-669a AGUUGUGUGUGCAUGUUCAUGU
ENST00000263640 MI0004667 mmu-miR-669a AGUUGUGUGUGCAUGUUCAUGU
ENST00000263640 MI0004668 mmu-miR-669a AGUUGUGUGUGCAUGUUCAUGU
ENST00000263640 MI0004650 mmu-miR-686 AUUGCUUCCCAGACGGUGAAGA
ENST00000263640 MI0004660 mmu-miR-692 AUCUCUUUGAGCGCCUCACUC
ENST00000263640 MI0004661 mmu-miR-692 AUCUCUUUGAGCGCCUCACUC
ENST00000263640 MI0004708 mmu-miR-721 CAGUGCAAUUAAAAGGGGGAA
ENST00000263640 MI0004516 mmu-miR-763 CCAGCUGGGAAGAACCAGUGGC
ENST00000263640 MI0005477 mmu-miR-883b-5p UACUGAGAAUGGGUAGCAGUCA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

[ - ] Somatic Mutations in Cancer - Sanger's COSMIC

The mutation data was obtained from the Sanger Institute Catalogue Of Somatic Mutations In Cancer web site, http://www.sanger.ac.uk/cosmic Bamford et al (2004) The COSMIC (Catalogue of Somatic Mutations in Cancer) database and website. Br J Cancer, 91,355-358.
Mutation (top 10)Total Observations
c.343C>T1
Primary Site / Histology (Top 10)Mutations (sites * observations)
skin / malignant melanoma1

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Cholecalciferol
  • Cholecalciferol results in increased expression of ACVR1 mRNA
17170073
Lindane
  • Lindane results in decreased expression of ACVR1 mRNA
17785943
Paraquat
  • Paraquat affects the expression of ACVR1 mRNA
15206577

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Myositis Ossificans marker
Agricultural Workers' Diseases inferred via Paraquat 11874814
Gliosis inferred via Paraquat 11124998
Nerve Degeneration inferred via Paraquat 16893418
Parkinson Disease inferred via Paraquat 12911755, 15824117, 11181820, 15451049, 16510128, 11124998, 11445065, 16140633
Pneumonia inferred via Paraquat 12504350
Pulmonary Fibrosis inferred via Paraquat 16324872, 17997886
Respiratory Distress Syndrome, Adult inferred via Paraquat 11700416
Respiratory Sounds inferred via Paraquat 11874814
Retinal Degeneration inferred via Paraquat 16458197
Agricultural Workers' Diseases inferred via Lindane 12661182
Breast Neoplasms inferred via Lindane 14688026
Neoplasms inferred via Lindane 16818664, 12807735
Prostatic Neoplasms inferred via Lindane 14688026, 12661182
Seizures inferred via Lindane 7539098
Autoimmune Diseases inferred via Cholecalciferol 16142846
Prostatic Neoplasms inferred via Cholecalciferol 17024972

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
1200013B22Rik ACVR1 / 1200013B22Rik Affinity Capture-Luminescence Barrios-Rodiles M (2005)
5830461H18Rik ACVR1 / 5830461H18Rik Affinity Capture-Luminescence Barrios-Rodiles M (2005)
ACVR1B ACVR1B / ACVR1 Affinity Capture-Western De Winter JP (1996)
Ap2b1 ACVR1 / Ap2b1 Affinity Capture-Luminescence Barrios-Rodiles M (2005)
BMP7 BMP7 / ACVR1 Reconstituted Complex ten Dijke P (1994)
BMPR2 ACVR1 / BMPR2 Affinity Capture-Western Liu F (1995)
BMPR2 BMPR2 / ACVR1 Affinity Capture-Western Liu F (1995)
BMPR2 ACVR1 / BMPR2 Two-hybrid Liu F (1995)
BMPR2 BMPR2 / ACVR1 Two-hybrid Liu F (1995)
Chn1 ACVR1 / Chn1 Affinity Capture-Luminescence Barrios-Rodiles M (2005)
ENG ENG / ACVR1 Affinity Capture-Western Barbara NP (1999)
Fancl ACVR1 / Fancl Affinity Capture-Luminescence Barrios-Rodiles M (2005)
Fbxo3 ACVR1 / Fbxo3 Affinity Capture-Luminescence Barrios-Rodiles M (2005)
Fcho1 ACVR1 / Fcho1 Affinity Capture-Luminescence Barrios-Rodiles M (2005)
Fgd6 ACVR1 / Fgd6 Affinity Capture-Luminescence Barrios-Rodiles M (2005)
Fkbp4 ACVR1 / Fkbp4 Affinity Capture-Luminescence Barrios-Rodiles M (2005)
FNTA ACVR1 / FNTA Two-hybrid Wang T (1996)
GDF5 ACVR1 / GDF5 Affinity Capture-Western Nishitoh H (1996)
Ikbkb ACVR1 / Ikbkb Affinity Capture-Luminescence Barrios-Rodiles M (2005)
Ilkap ACVR1 / Ilkap Affinity Capture-Luminescence Barrios-Rodiles M (2005)
Jub ACVR1 / Jub Affinity Capture-Luminescence Barrios-Rodiles M (2005)
Nat5 ACVR1 / Nat5 Affinity Capture-Luminescence Barrios-Rodiles M (2005)
Nkiras1 ACVR1 / Nkiras1 Affinity Capture-Luminescence Barrios-Rodiles M (2005)
Nras ACVR1 / Nras Affinity Capture-Luminescence Barrios-Rodiles M (2005)
Pftk1 ACVR1 / Pftk1 Affinity Capture-Luminescence Barrios-Rodiles M (2005)
Plek ACVR1 / Plek Affinity Capture-Luminescence Barrios-Rodiles M (2005)
Plekhb1 ACVR1 / Plekhb1 Affinity Capture-Luminescence Barrios-Rodiles M (2005)
Rab17 ACVR1 / Rab17 Affinity Capture-Luminescence Barrios-Rodiles M (2005)
Rab33b ACVR1 / Rab33b Affinity Capture-Luminescence Barrios-Rodiles M (2005)
Rab3b ACVR1 / Rab3b Affinity Capture-Luminescence Barrios-Rodiles M (2005)
Rab6b ACVR1 / Rab6b Affinity Capture-Luminescence Barrios-Rodiles M (2005)
Rasd2 ACVR1 / Rasd2 Affinity Capture-Luminescence Barrios-Rodiles M (2005)
Rhebl1 ACVR1 / Rhebl1 Affinity Capture-Luminescence Barrios-Rodiles M (2005)
Rhobtb1 ACVR1 / Rhobtb1 Affinity Capture-Luminescence Barrios-Rodiles M (2005)
Rhod ACVR1 / Rhod Affinity Capture-Luminescence Barrios-Rodiles M (2005)
Rhoj ACVR1 / Rhoj Affinity Capture-Luminescence Barrios-Rodiles M (2005)
Rps27a ACVR1 / Rps27a Affinity Capture-Luminescence Barrios-Rodiles M (2005)
Rras2 ACVR1 / Rras2 Affinity Capture-Luminescence Barrios-Rodiles M (2005)
SMAD1 ACVR1 / SMAD1 Affinity Capture-Western Macias-Silva M (1998)
SMAD1 ACVR1 / SMAD1 Affinity Capture-Western Pardali E (2000)
SMAD5 ACVR1 / SMAD5 Affinity Capture-Western Macias-Silva M (1998)
SMAD5 ACVR1 / SMAD5 Affinity Capture-Western Pardali E (2000)
Sqstm1 ACVR1 / Sqstm1 Affinity Capture-Luminescence Barrios-Rodiles M (2005)
Stat1 ACVR1 / Stat1 Affinity Capture-Luminescence Barrios-Rodiles M (2005)
Stx8 ACVR1 / Stx8 Affinity Capture-Luminescence Barrios-Rodiles M (2005)
Tgfbr1 ACVR1 / Tgfbr1 Affinity Capture-Luminescence Barrios-Rodiles M (2005)
Ube2e3 ACVR1 / Ube2e3 Affinity Capture-Luminescence Barrios-Rodiles M (2005)
Ube2r2 ACVR1 / Ube2r2 Affinity Capture-Luminescence Barrios-Rodiles M (2005)
Uhmk1 ACVR1 / Uhmk1 Affinity Capture-Luminescence Barrios-Rodiles M (2005)
Usp21 ACVR1 / Usp21 Affinity Capture-Luminescence Barrios-Rodiles M (2005)
Usp39 ACVR1 / Usp39 Affinity Capture-Luminescence Barrios-Rodiles M (2005)
Wdr61 ACVR1 / Wdr61 Affinity Capture-Luminescence Barrios-Rodiles M (2005)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Santiago-Sim T, et al. (2009) "Sequencing of TGF-beta pathway genes in familial cases of intracranial aneurysm." Stroke. 40(5):1604-1611. PMID:19299629
  2. [ + ] Kim YI, et al. (2009) "Cell growth regulation through apoptosis by activin in human gastric cancer SNU-16 cell lines." Oncol Rep. 21(2):491-497. PMID:19148527
  3. [ + ] Kaplan FS, et al. (2009) "Classic and atypical fibrodysplasia ossificans progressiva (FOP) phenotypes are caused by mutations in the bone morphogenetic protein (BMP) type I receptor ACVR1." Hum Mutat. 30(3):379-390. PMID:19085907
  4. [ + ] Miyoshi T, et al. (2009) "Relationship between activin A level and infarct size in patients with acute myocardial infarction undergoing successful primary coronary intervention." Clin Chim Acta. 401(1-2):3-7. PMID:19028479
  5. [ + ] Kevenaar ME, et al. (2009) "Variants in the ACVR1 gene are associated with AMH levels in women with polycystic ovary syndrome." Hum Reprod. 24(1):241-249. PMID:18854405
  6. [ + ] Bocciardi R, et al. (2009) "Mutational analysis of the ACVR1 gene in Italian patients affected with fibrodysplasia ossificans progressiva: confirmations and advancements." Eur J Hum Genet. 17(3):311-318. PMID:18830232
  7. [ + ] Fukuda T, et al. (2009) "Constitutively activated ALK2 and increased SMAD1/5 cooperatively induce bone morphogenetic protein signaling in fibrodysplasia ossificans progressiva." J Biol Chem. 284(11):7149-7156. PMID:18684712
  8. [ + ] Petrie KA, et al. (2009) "Novel mutations in ACVR1 result in atypical features in two fibrodysplasia ossificans progressiva patients." PLoS One. 4(3):e5005. PMID:19330033
  9. [ + ] Saha S, et al. (2008) "TGFbeta/Activin/Nodal pathway in inhibition of human embryonic stem cell differentiation by mechanical strain." Biophys J. 94(10):4123-4133. PMID:18234825
  10. [ + ] Fukuda T, et al. (2008) "A unique mutation of ALK2, G356D, found in a patient with fibrodysplasia ossificans progressiva is a moderately activated BMP type I receptor." Biochem Biophys Res Commun. 377(3):905-909. PMID:18952055
  11. [ + ] Palmieri RT, et al. (2008) "Polymorphism in the IL18 gene and epithelial ovarian cancer in non-Hispanic white women." Cancer Epidemiol Biomarkers Prev. 17(12):3567-3572. PMID:19064572
  12. [ + ] Lavery K, et al. (2008) "BMP-2/4 and BMP-6/7 differentially utilize cell surface receptors to induce osteoblastic differentiation of human bone marrow-derived mesenchymal stem cells." J Biol Chem. 283(30):20948-20958. PMID:18436533
  13. [ + ] Kariyawasam HH, et al. (2008) "Basal expression of bone morphogenetic protein receptor is reduced in mild asthma." Am J Respir Crit Care Med. 177(10):1074-1081. PMID:18292470
  14. [ + ] Groppe JC, et al. (2007) "Functional modeling of the ACVR1 (R206H) mutation in FOP." Clin Orthop Relat Res. 462():87-92. PMID:17572636
  15. [ + ] Lucotte G, et al. (2007) "Mutations of the noggin and of the activin A type I receptor genes in fibrodysplasia ossificans progressiva (FOP)." Genet Couns. 18(3):349-352. PMID:18019378
  16. [ + ] Craft CS, et al. (2007) "Endoglin inhibits prostate cancer motility via activation of the ALK2-Smad1 pathway." Oncogene. 26(51):7240-7250. PMID:17496924
  17. [ + ] Nakajima M, et al. (2007) "The ACVR1 617G>A mutation is also recurrent in three Japanese patients with fibrodysplasia ossificans progressiva." J Hum Genet. 52(5):473-475. PMID:17351709
  18. [ + ] Shore EM, et al. (2006) "A recurrent mutation in the BMP type I receptor ACVR1 causes inherited and sporadic fibrodysplasia ossificans progressiva." Nat Genet. 38(5):525-527. PMID:16642017
  19. [ + ] Kimura K, et al. (2006) "Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes." Genome Res. 16(1):55-65. PMID:16344560
  20. [ + ] Barrios-Rodiles M, et al. (2005) "High-throughput mapping of a dynamic signaling network in mammalian cells." Science. 307(5715):1621-1625. PMID:15761153
  21. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  22. [ + ] Casagrandi D, et al. (2003) "Inhibin, activin, follistatin, activin receptors and beta-glycan gene expression in the placental tissue of patients with pre-eclampsia." Mol Hum Reprod. 9(4):199-203. PMID:12651901
  23. [ + ] Chen VT, et al. (2003) "Activin-A up-regulates type I activin receptor mRNA levels in human immortalized extravillous trophoblast cells." Reprod Biol Endocrinol. 1():29. PMID:12702211
  24. [ + ] Inman GJ, et al. (2002) "SB-431542 is a potent and specific inhibitor of transforming growth factor-beta superfamily type I activin receptor-like kinase (ALK) receptors ALK4, ALK5, and ALK7." Mol Pharmacol. 62(1):65-74. PMID:12065756
  25. [ + ] Schneider-Kolsky ME, et al. (2002) "The distribution of activin and activin receptors in gestational tissues across human pregnancy and during labour." Placenta. 23(4):294-302. PMID:11969340
  26. [ + ] Welt CK, et al. (2002) "The physiology and pathophysiology of inhibin, activin and follistatin in female reproduction." Curr Opin Obstet Gynecol. 14(3):317-323. PMID:12032389
  27. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  28. [ + ] Chapman SC, et al. (2001) "Modulation of activin signal transduction by inhibin B and inhibin-binding protein (INhBP)." Mol Endocrinol. 15(4):668-679. PMID:11266516
  29. [ + ] Schulte KM, et al. (2000) "Activin A and activin receptors in the human thyroid: a link to the female predominance of goiter?" Horm Metab Res. 32(10):390-400. PMID:11069203
  30. [ + ] Pardali E, et al. (2000) "Smad and AML proteins synergistically confer transforming growth factor beta1 responsiveness to human germ-line IgA genes." J Biol Chem. 275(5):3552-3560. PMID:10652350
  31. [ + ] Barbara NP, et al. (1999) "Endoglin is an accessory protein that interacts with the signaling receptor complex of multiple members of the transforming growth factor-beta superfamily." J Biol Chem. 274(2):584-594. PMID:9872992
  32. [ + ] Nishita M, et al. (1999) "Smad8B, a Smad8 splice variant lacking the SSXS site that inhibits Smad8-mediated signalling." Genes Cells. 4(10):583-591. PMID:10583507
  33. [ + ] Brown JD, et al. (1999) "MEKK-1, a component of the stress (stress-activated protein kinase/c-Jun N-terminal kinase) pathway, can selectively activate Smad2-mediated transcriptional activation in endothelial cells." J Biol Chem. 274(13):8797-8805. PMID:10085121
  34. [ + ] Macias-Silva M, et al. (1998) "Specific activation of Smad1 signaling pathways by the BMP7 type I receptor, ALK2." J Biol Chem. 273(40):25628-25636. PMID:9748228
  35. [ + ] Hashimoto O, et al. (1998) "The role of activin type I receptors in activin A-induced growth arrest and apoptosis in mouse B-cell hybridoma cells." Cell Signal. 10(10):743-749. PMID:9884026
  36. [ + ] Roijer E, et al. (1998) "Chromosomal localization of three human genes encoding members of the TGF-beta superfamily of type I serine/threonine kinase receptors." Mamm Genome. 9(3):266-268. PMID:9501322
  37. [ + ] Chen H, et al. (1997) "Nuclear receptor coactivator ACTR is a novel histone acetyltransferase and forms a multimeric activation complex with P/CAF and CBP/p300." Cell. 90(3):569-580. PMID:9267036
  38. [ + ] Kretzschmar M, et al. (1997) "The TGF-beta family mediator Smad1 is phosphorylated directly and activated functionally by the BMP receptor kinase." Genes Dev. 11(8):984-995. PMID:9136927
  39. [ + ] De Winter JP, et al. (1996) "Truncated activin type II receptors inhibit bioactivity by the formation of heteromeric complexes with activin type I. receptors." Exp Cell Res. 224(2):323-334. PMID:8612709
  40. [ + ] Nishitoh H, et al. (1996) "Identification of type I and type II serine/threonine kinase receptors for growth/differentiation factor-5." J Biol Chem. 271(35):21345-21352. PMID:8702914
  41. [ + ] Attisano L, et al. (1996) "Activation of signalling by the activin receptor complex." Mol Cell Biol. 16(3):1066-1073. PMID:8622651
  42. [ + ] Wang T, et al. (1996) "The p21(RAS) farnesyltransferase alpha subunit in TGF-beta and activin signaling." Science. 271(5252):1120-1122. PMID:8599089
  43. [ + ] Kawabata M, et al. (1995) "Cloning of a novel type II serine/threonine kinase receptor through interaction with the type I transforming growth factor-beta receptor." J Biol Chem. 270(10):5625-5630. PMID:7890683
  44. [ + ] Liu F, et al. (1995) "Human type II receptor for bone morphogenic proteins (BMPs): extension of the two-kinase receptor model to the BMPs." Mol Cell Biol. 15(7):3479-3486. PMID:7791754
  45. [ + ] ten Dijke P, et al. (1994) "Identification of type I receptors for osteogenic protein-1 and bone morphogenetic protein-4." J Biol Chem. 269(25):16985-16988. PMID:8006002
  46. [ + ] Matsuzaki K, et al. (1993) "A widely expressed transmembrane serine/threonine kinase that does not bind activin, inhibin, transforming growth factor beta, or bone morphogenic factor." J Biol Chem. 268(17):12719-12723. PMID:8389764
  47. [ + ] Tsuchida K, et al. (1993) "Cloning and characterization of a transmembrane serine kinase that acts as an activin type I receptor." Proc Natl Acad Sci U S A. 90(23):11242-11246. PMID:8248234
  48. [ + ] Attisano L, et al. (1993) "Identification of human activin and TGF beta type I receptors that form heteromeric kinase complexes with type II receptors." Cell. 75(4):671-680. PMID:8242742
  49. [ + ] ten Dijke P, et al. (1993) "Activin receptor-like kinases: a novel subclass of cell-surface receptors with predicted serine/threonine kinase activity." Oncogene. 8(10):2879-2887. PMID:8397373