ABCC10 | GeneID:89845 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 89845 Official Symbol ABCC10
Locus RP5-895C5.1 Gene Type protein-coding
Synonyms EST182763; MRP7; SIMRP7
Full Name ATP-binding cassette, sub-family C (CFTR/MRP), member 10
Description ATP-binding cassette, sub-family C (CFTR/MRP), member 10
Chromosome 6p21.1
Also Known As ATP-binding cassette, sub-family C, member 10; multidrug resistance-associated protein 7
Summary The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This ABC full-transporter is a member of the MRP subfamily which is involved in multi-drug resistance. Alternative splicing of this gene results in multiple transcript variants; however, not all variants have been fully described. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 58616

ID Symbol Protein Species
GeneID:34140 CG7806 NP_609207.1 Drosophila melanogaster
GeneID:89845 ABCC10 NP_258261.2 Homo sapiens
GeneID:224814 Abcc10 NP_733780.1 Mus musculus
GeneID:316231 Abcc10 XP_236930.4 Rattus norvegicus
GeneID:421456 ABCC10 XP_419506.2 Gallus gallus
GeneID:462717 ABCC10 XP_518494.2 Pan troglodytes
GeneID:481813 ABCC10 XP_538934.2 Canis lupus familiaris
GeneID:508399 ABCC10 XP_585169.3 Bos taurus
GeneID:815414 ATMRP11 NP_178811.3 Arabidopsis thaliana
GeneID:1278042 AgaP_AGAP007917 XP_317569.2 Anopheles gambiae
GeneID:4340331 Os06g0184700 NP_001056996.1 Oryza sativa

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab69296 ABCC10 antibody (ab69296); Mouse polyclonal to ABCC10
2 acris AP01410PU-N ABCC10 / MRP7; antibody Ab
3 scbt ABCC10 ABCC10 Antibody / ABCC10 Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of ABCC10 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ABCC10 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0005886 Component plasma membrane
GO:0016887 Function ATPase activity
GO:0042626 Function ATPase activity, coupled to transmembrane movement of substances
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_033450  UCSC Browser NP_258261

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000244533 MI0000065 hsa-let-7d AGAGGUAGUAGGUUGCAUAGUU
ENST00000244533 MI0000433 hsa-let-7g UGAGGUAGUAGUUUGUACAGUU
ENST00000244533 MI0000437 hsa-miR-1 UGGAAUGUAAAGAAGUAUGUAU
ENST00000244533 MI0000651 hsa-miR-1 UGGAAUGUAAAGAAGUAUGUAU
ENST00000244533 MI0000289 hsa-miR-181a* ACCAUCGACCGUUGAUUGUACC
ENST00000244533 MI0003130 hsa-miR-202* UUCCUAUGCAUAUACUUCUUUG
ENST00000244533 MI0000490 hsa-miR-206 UGGAAUGUAAGGAAGUGUGUGG
ENST00000244533 MI0000080 hsa-miR-24-1* UGCCUACUGAGCUGAUAUCAGU
ENST00000244533 MI0000088 hsa-miR-30a UGUAAACAUCCUCGACUGGAAG
ENST00000244533 MI0000441 hsa-miR-30b UGUAAACAUCCUACACUCAGCU
ENST00000244533 MI0000254 hsa-miR-30c UGUAAACAUCCUACACUCUCAGC
ENST00000244533 MI0000736 hsa-miR-30c UGUAAACAUCCUACACUCUCAGC
ENST00000244533 MI0000255 hsa-miR-30d UGUAAACAUCCCCGACUGGAAG
ENST00000244533 MI0000749 hsa-miR-30e UGUAAACAUCCUUGACUGGAAG
ENST00000244533 MI0000089 hsa-miR-31* UGCUAUGCCAACAUAUUGCCAU
ENST00000244533 MI0000782 hsa-miR-374a* CUUAUCAGAUUGUAUUGUAAUU
ENST00000244533 MI0000789 hsa-miR-381 UAUACAAGGGCAAGCUCUCUGU
ENST00000244533 MI0000791 hsa-miR-383 AGAUCAGAAGGUGAUUGUGGCU
ENST00000244533 MI0003149 hsa-miR-520a-5p CUCCAGAGGGAAGUACUUUCU
ENST00000244533 MI0003596 hsa-miR-548b-3p CAAGAACCUCAGUUGCUUUUGU
ENST00000244533 MI0003668 hsa-miR-548d-3p CAAAAACCACAGUUUCUUUUGC
ENST00000244533 MI0003671 hsa-miR-548d-3p CAAAAACCACAGUUUCUUUUGC
ENST00000244533 MI0003568 hsa-miR-562 AAAGUAGCUGUACCAUUUGC
ENST00000244533 MI0003602 hsa-miR-590-3p UAAUUUUAUGUAUAAGCUAGU
ENST00000244533 MI0003607 hsa-miR-595 GAAGUGUGCCGUGGUGUGUCU
ENST00000244533 MI0003622 hsa-miR-609 AGGGUGUUUCUCUCAUCUCU
ENST00000244533 MI0003624 hsa-miR-611 GCGAGGACCCCUCGGGGUCUGAC
ENST00000244533 MI0003626 hsa-miR-613 AGGAAUGUUCCUUCUUUGCC
ENST00000244533 MI0003677 hsa-miR-655 AUAAUACAUGGUUAACCUCUUU
ENST00000244533 MI0003678 hsa-miR-656 AAUAUUAUACAGUCAACCUCU
ENST00000244533 MI0003683 hsa-miR-659 CUUGGUUCAGGGAGGGUCCCCA
ENST00000244533 MI0003760 hsa-miR-671-5p AGGAAGCCCUGGAGGGGCUGGAG
ENST00000244533 MI0005116 hsa-miR-765 UGGAGGAGAAGGAAGGUGAUG
ENST00000244533 MI0005118 hsa-miR-770-5p UCCAGUACCACGUGUCAGGGCCA
ENST00000244533 MI0005542 hsa-miR-876-3p UGGUGGUUUACAAAGUAAUUCA
ENST00000244533 MI0000466 hsa-miR-9* AUAAAGCUAGAUAACCGAAAGU
ENST00000244533 MI0000467 hsa-miR-9* AUAAAGCUAGAUAACCGAAAGU
ENST00000244533 MI0000468 hsa-miR-9* AUAAAGCUAGAUAACCGAAAGU
ENST00000244533 MI0002637 mml-miR-189 GUGCCUACUGAGCUGAUAUCAGU
ENST00000244533 MI0003518 mmu-miR-540-3p AGGUCAGAGGUCGAUCCUGG
ENST00000244533 MI0004675 mmu-miR-695 AGAUUGGGCAUAGGUGACUGAA
ENST00000244533 MI0004690 mmu-miR-706 AGAGAAACCCUGUCUCAAAAAA
ENST00000244533 MI0004554 mmu-miR-759 GCAGAGUGCAAACAAUUUUGAC
ENST00000244533 MI0000644 rno-miR-352 AGAGUAGUAGGUUGCAUAGUA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
1,4-bis(2-(3,5-dichloropyridyloxy))benzene
  • [1,4-bis(2-(3,5-dichloropyridyloxy))benzene results in increased activity of NR1I3 protein] which results in increased expression of ABCC10 mRNA
  • 1,4-bis(2-(3,5-dichloropyridyloxy))benzene results in increased expression of ABCC10 mRNA
15833929
2-Acetylaminofluorene
  • 2-Acetylaminofluorene results in increased expression of ABCC10 mRNA
12566991
trichostatin A
  • trichostatin A results in increased expression of ABCC10 mRNA
12566991

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Adenoma inferred via 2-Acetylaminofluorene 10737359
Carcinoma, Hepatocellular inferred via 2-Acetylaminofluorene 10737359
Liver Neoplasms inferred via 2-Acetylaminofluorene 10737359, 14678523, 10672840, 11376686, 16273603, 18001218
Lung Neoplasms inferred via 2-Acetylaminofluorene 11376686
Urinary Bladder Neoplasms inferred via 2-Acetylaminofluorene 15867355, 15289314

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Saito A, et al. (2009) "Association study between single-nucleotide polymorphisms in 199 drug-related genes and commonly measured quantitative traits of 752 healthy Japanese subjects." J Hum Genet. 54(6):317-323. PMID:19343046
  2. [ + ] Bessho Y, et al. (2009) "ABCC10/MRP7 is associated with vinorelbine resistance in non-small cell lung cancer." Oncol Rep. 21(1):263-268. PMID:19082471
  3. [ + ] Naramoto H, et al. (2007) "Multidrug resistance-associated protein 7 expression is involved in cross-resistance to docetaxel in salivary gland adenocarcinoma cell lines." Int J Oncol. 30(2):393-401. PMID:17203221
  4. [ + ] Wooden SL, et al. (2005) "Cutting edge: HLA-E binds a peptide derived from the ATP-binding cassette transporter multidrug resistance-associated protein 7 and inhibits NK cell-mediated lysis." J Immunol. 175(3):1383-1387. PMID:16034073
  5. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  6. [ + ] Hopper-Borge E, et al. (2004) "Analysis of the drug resistance profile of multidrug resistance protein 7 (ABCC10): resistance to docetaxel." Cancer Res. 64(14):4927-4930. PMID:15256465
  7. [ + ] Kao HH, et al. (2003) "Genomic structure, gene expression, and promoter analysis of human multidrug resistance-associated protein 7." J Biomed Sci. 10(1):98-110. PMID:12566991
  8. [ + ] Chen ZS, et al. (2003) "Characterization of the transport properties of human multidrug resistance protein 7 (MRP7, ABCC10)." Mol Pharmacol. 63(2):351-358. PMID:12527806
  9. [ + ] Mungall AJ, et al. (2003) "The DNA sequence and analysis of human chromosome 6." Nature. 425(6960):805-811. PMID:14574404
  10. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  11. [ + ] Hopper E, et al. (2001) "Analysis of the structure and expression pattern of MRP7 (ABCC10), a new member of the MRP subfamily." Cancer Lett. 162(2):181-191. PMID:11146224
  12. [ + ] Allikmets R, et al. (1996) "Characterization of the human ABC superfamily: isolation and mapping of 21 new genes using the expressed sequence tags database." Hum Mol Genet. 5(10):1649-1655. PMID:8894702