FUBP3 | GeneID:8939 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 8939 Official Symbol FUBP3
Locus N/A Gene Type protein-coding
Synonyms FBP3; FLJ25229
Full Name far upstream element (FUSE) binding protein 3
Description far upstream element (FUSE) binding protein 3
Chromosome 9q34.11-q34.12
Also Known As OTTHUMP00000022369
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 45954

ID Symbol Protein Species
GeneID:8939 FUBP3 NP_003925.1 Homo sapiens
GeneID:320267 Fubp3 NP_001028561.1 Mus musculus
GeneID:362106 Fubp3 NP_001034426.1 Rattus norvegicus
GeneID:417184 FUBP3 NP_001006199.1 Gallus gallus
GeneID:464800 FUBP3 XP_520317.2 Pan troglodytes
GeneID:493616 zgc:101598 NP_001007777.1 Danio rerio
GeneID:541080 FUBP3 XP_614453.2 Bos taurus
GeneID:608171 FUBP3 XP_849868.1 Canis lupus familiaris

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab71401 FUBP3 antibody - N-terminal (ab71401); Rabbit polyclonal to FUBP3 - N-terminal
2 abcam ab67957 FUBP3 antibody (ab67957); Mouse polyclonal to FUBP3
3 abcam ab71400 FUBP3 antibody (ab71400); Rabbit polyclonal to FUBP3
4 abgent AP1916a FUBP3 Antibody (Center); Purified Rabbit Polyclonal Antibody (Pab)
5 abgent AP1916b FUBP3 Antibody (N-term); Purified Rabbit Polyclonal Antibody (Pab)
6 acris AP11707PU-N FUBP3 (Center); antibody Ab
7 acris AP11708PU-N FUBP3 (N-term); antibody Ab
8 scbt FUBP3 FUBP3 Antibody / FUBP3 Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of FUBP3 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of FUBP3 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005634 Component nucleus
GO:0003677 Function DNA binding
GO:0005515 Function protein binding
GO:0003723 Function RNA binding
GO:0016563 Function transcription activator activity
GO:0006355 Process regulation of transcription, DNA-dependent
GO:0006350 Process transcription

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_003934  UCSC Browser NP_003925 A3KFK8   Q96I24  

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000319725 MI0000102 hsa-miR-100* CAAGCUUGUAUCUAUAGGUAUG
ENST00000319725 MI0000454 hsa-miR-137 UUAUUGCUUAAGAAUACGCGUAG
ENST00000319725 MI0000479 hsa-miR-150 UCUCCCAACCCUUGUACCAGUG
ENST00000319725 MI0000342 hsa-miR-200b UAAUACUGCCUGGUAAUGAUGA
ENST00000319725 MI0000078 hsa-miR-22* AGUUCUUCAGUGGCAAGCUUUA
ENST00000319725 MI0000812 hsa-miR-331-5p CUAGGUAUGGUCCCAGGGAUCC
ENST00000319725 MI0000767 hsa-miR-365 UAAUGCCCCUAAAAAUCCUUAU
ENST00000319725 MI0000769 hsa-miR-365 UAAUGCCCCUAAAAAUCCUUAU
ENST00000319725 MI0003183 hsa-miR-499-5p UUAAGACUUGCAGUGAUGUUU
ENST00000319725 MI0003194 hsa-miR-507 UUUUGCACCUUUUGGAGUGAA
ENST00000319725 MI0003596 hsa-miR-548b-3p CAAGAACCUCAGUUGCUUUUGU
ENST00000319725 MI0003562 hsa-miR-556-3p AUAUUACCAUUAGCUCAUCUUU
ENST00000319725 MI0003578 hsa-miR-571 UGAGUUGGCCAUCUGAGUGAG
ENST00000319725 MI0003599 hsa-miR-589* UCAGAACAAAUGCCGGUUCCCAGA
ENST00000319725 MI0003602 hsa-miR-590-5p GAGCUUAUUCAUAAAAGUGCAG
ENST00000319725 MI0003626 hsa-miR-613 AGGAAUGUUCCUUCUUUGCC
ENST00000319725 MI0003632 hsa-miR-618 AAACUCUACUUGUCCUUCUGAGU
ENST00000319725 MI0000635 rno-miR-347 UGUCCCUCUGGGUCGCCCA
ENST00000372378 MI0000454 hsa-miR-137 UUAUUGCUUAAGAAUACGCGUAG
ENST00000372378 MI0000078 hsa-miR-22* AGUUCUUCAGUGGCAAGCUUUA
ENST00000372378 MI0005529 hsa-miR-220b CCACCACCGUGUCUGACACUU
ENST00000372378 MI0000812 hsa-miR-331-5p CUAGGUAUGGUCCCAGGGAUCC
ENST00000372378 MI0003183 hsa-miR-499-5p UUAAGACUUGCAGUGAUGUUU
ENST00000372378 MI0003578 hsa-miR-571 UGAGUUGGCCAUCUGAGUGAG
ENST00000372378 MI0003599 hsa-miR-589* UCAGAACAAAUGCCGGUUCCCAGA
ENST00000372378 MI0003602 hsa-miR-590-5p GAGCUUAUUCAUAAAAGUGCAG
ENST00000372378 MI0003681 hsa-miR-657 GGCAGGUUCUCACCCUCUCUAGG
ENST00000372378 MI0005560 hsa-miR-885-5p UCCAUUACACUACCCUGCCUCU
ENST00000372378 MI0004196 mmu-miR-667 UGACACCUGCCACCCAGCCCAAG
ENST00000372378 MI0005473 mmu-miR-880 UACUCCAUCCUCUCUGAGUAGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Thiophenes
  • Thiophenes analog does not affect the reaction [Tretinoin results in decreased expression of FUBP3 mRNA]
16140955
Tretinoin
  • Thiophenes analog does not affect the reaction [Tretinoin results in decreased expression of FUBP3 mRNA]
  • Tretinoin results in decreased expression of FUBP3 mRNA
16140955

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Alopecia inferred via Tretinoin 15955085
Arthritis, Experimental inferred via Tretinoin 16412693
Arthritis, Rheumatoid inferred via Tretinoin 16292516
Asthma inferred via Tretinoin 16456186
Barrett Esophagus inferred via Tretinoin 16935849
Blood Coagulation Disorders inferred via Tretinoin 16197459, 16206674
Breast Neoplasms inferred via Tretinoin 16873071, 16443354, 16166294
Bronchopulmonary Dysplasia inferred via Tretinoin 16813970
Carcinoma, Embryonal inferred via Tretinoin 16168501
Carcinoma, Squamous Cell inferred via Tretinoin 16096774, 16051514
Cataract inferred via Tretinoin 17460283
Cervical Intraepithelial Neoplasia inferred via Tretinoin 16129372
Choriocarcinoma inferred via Tretinoin 16461808
Colitis inferred via Tretinoin 17035595
Craniofacial Abnormalities inferred via Tretinoin 16925845
Endometrial Neoplasms inferred via Tretinoin 16569247
Eye Abnormalities inferred via Tretinoin 16938888
Glioblastoma inferred via Tretinoin 17312396
Head and Neck Neoplasms inferred via Tretinoin 16096774
Hearing Loss, Noise-Induced inferred via Tretinoin 16084493
Hyperalgesia inferred via Tretinoin 16870215
Hypereosinophilic Syndrome inferred via Tretinoin 16778211
Leukemia inferred via Tretinoin 17143497
Leukemia, Myeloid inferred via Tretinoin 16932348, 16482212
Leukemia, Myeloid, Acute inferred via Tretinoin 16294345
Leukemia, Promyelocytic, Acute inferred via Tretinoin 16891316, 12679006, 15748426, 16788101, 16766008, 17506722, 17301526, 17361223, 16140955, 16331271, 17294898, 17368321, 17339181, 17217047, 17107899, 16935935, 16823087
Liver Cirrhosis, Experimental inferred via Tretinoin 16248980, 18397230
Medulloblastoma inferred via Tretinoin 17453147
Melanoma inferred via Tretinoin 16752155
Meningomyelocele inferred via Tretinoin 16940565
Neoplasms inferred via Tretinoin 16946489, 16594593
Ovarian Neoplasms inferred via Tretinoin 16936753
Pain inferred via Tretinoin 16870215
Pancreatic Neoplasms inferred via Tretinoin 15976015
Pterygium inferred via Tretinoin 16723453
Rhabdomyosarcoma inferred via Tretinoin 16116481, 16283617
Skin Neoplasms inferred via Tretinoin 16467112
Stomach Neoplasms inferred via Tretinoin 17261132
Thyroid Neoplasms inferred via Tretinoin 17045167, 16026305
Tongue Neoplasms inferred via Tretinoin 16051514
Tuberculosis inferred via Tretinoin 16040207
Uterine Cervical Neoplasms inferred via Tretinoin 16129372
Uveal Neoplasms inferred via Tretinoin 16752155
Vitiligo inferred via Tretinoin 16761959
Wilms Tumor inferred via Tretinoin 16287080
Leukemia, Promyelocytic, Acute inferred via Thiophenes 16140954, 16140955

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Lettre G, et al. (2008) "Identification of ten loci associated with height highlights new biological pathways in human growth." Nat Genet. 40(5):584-591. PMID:18391950
  2. [ + ] Wu C, et al. (2007) "Systematic identification of SH3 domain-mediated human protein-protein interactions by peptide array target screening." Proteomics. 7(11):1775-1785. PMID:17474147
  3. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  4. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  5. [ + ] Davis-Smyth T, et al. (1996) "The far upstream element-binding proteins comprise an ancient family of single-strand DNA-binding transactivators." J Biol Chem. 271(49):31679-31687. PMID:8940189