A2LD1 | GeneID:87769 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 87769 Official Symbol A2LD1
Locus RP11-151A6.2 Gene Type protein-coding
Synonyms
Full Name AIG2-like domain 1
Description AIG2-like domain 1
Chromosome 13q32.3
Also Known As OTTHUMP00000040728
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 15522

ID Symbol Protein Species
GeneID:37989 Tina-1 NP_611983.2 Drosophila melanogaster
GeneID:87769 A2LD1 XP_001714550.1 Homo sapiens
GeneID:223267 a2ld1 NP_663441.1 Mus musculus
GeneID:290500 A2ld1 NP_001020805.1 Rattus norvegicus
GeneID:418773 A2LD1 XP_416969.1 Gallus gallus
GeneID:447805 zgc:92115 NP_001004544.1 Danio rerio
GeneID:485534 A2LD1 XP_542653.2 Canis lupus familiaris
GeneID:777609 zgc:154024 NP_001071185.1 Danio rerio
GeneID:100038780 zgc:162208 NP_001083029.1 Danio rerio

Exon, Intron and UTRs

Exon, Intron and UTRs of A2LD1 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of A2LD1 Gene

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_033110  UCSC Browser NP_149101

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000257302 MI0000066 hsa-let-7e* CUAUACGGCCUCCUAGCUUUCC
ENST00000257302 MI0000437 hsa-miR-1 UGGAAUGUAAAGAAGUAUGUAU
ENST00000257302 MI0000651 hsa-miR-1 UGGAAUGUAAAGAAGUAUGUAU
ENST00000257302 MI0003129 hsa-miR-146b-3p UGCCCUGUGGACUCAGUUCUGG
ENST00000257302 MI0000077 hsa-miR-21* CAACACCAGUCGAUGGGCUGU
ENST00000257302 MI0000803 hsa-miR-330-3p GCAAAGCACACGGCCUGCAGAGA
ENST00000257302 MI0003158 hsa-miR-520c-3p AAAGUGCUUCCUUUUAGAGGGU
ENST00000257302 MI0003163 hsa-miR-521 AACGCACUUCCCUUUAGAGUGU
ENST00000257302 MI0003176 hsa-miR-521 AACGCACUUCCCUUUAGAGUGU
ENST00000257302 MI0003636 hsa-miR-622 ACAGUCUGCUGAGGUUGGAGC
ENST00000257302 MI0003642 hsa-miR-628-5p AUGCUGACAUAUUUACUAGAGG
ENST00000257302 MI0004671 mmu-miR-467b GUAAGUGCCUGCAUGUAUAUG
ENST00000376250 MI0000066 hsa-let-7e* CUAUACGGCCUCCUAGCUUUCC
ENST00000376250 MI0000068 hsa-let-7f-2* CUAUACAGUCUACUGUCUUUCC
ENST00000376250 MI0000102 hsa-miR-100* CAAGCUUGUAUCUAUAGGUAUG
ENST00000376250 MI0000267 hsa-miR-10b* ACAGAUUCGAUUCUAGGGGAAU
ENST00000376250 MI0000471 hsa-miR-126* CAUUAUUACUUUUGGUACGCG
ENST00000376250 MI0003129 hsa-miR-146b-3p UGCCCUGUGGACUCAGUUCUGG
ENST00000376250 MI0000289 hsa-miR-181a* ACCAUCGACCGUUGAUUGUACC
ENST00000376250 MI0000269 hsa-miR-181a-2* ACCACUGACCGUUGACUGUACC
ENST00000376250 MI0000489 hsa-miR-195* CCAAUAUUGGCUGUGCUGCUCC
ENST00000376250 MI0000077 hsa-miR-21* CAACACCAGUCGAUGGGCUGU
ENST00000376250 MI0000078 hsa-miR-22 AAGCUGCCAGUUGAAGAACUGU
ENST00000376250 MI0000087 hsa-miR-29a* ACUGAUUUCUUUUGGUGUUCAG
ENST00000376250 MI0000738 hsa-miR-302a* ACUUAAACGUGGAUGUACUUGCU
ENST00000376250 MI0000803 hsa-miR-330-3p GCAAAGCACACGGCCUGCAGAGA
ENST00000376250 MI0000779 hsa-miR-371-5p ACUCAAACUGUGGGGGCACU
ENST00000376250 MI0001448 hsa-miR-425 AAUGACACGAUCACUCCCGUUGA
ENST00000376250 MI0003188 hsa-miR-503 UAGCAGCGGGAACAGUUCUGCAG
ENST00000376250 MI0003196 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENST00000376250 MI0005530 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENST00000376250 MI0005717 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENST00000376250 MI0003163 hsa-miR-521 AACGCACUUCCCUUUAGAGUGU
ENST00000376250 MI0003176 hsa-miR-521 AACGCACUUCCCUUUAGAGUGU
ENST00000376250 MI0003153 hsa-miR-523 GAACGCGCUUCCCUAUAGAGGGU
ENST00000376250 MI0003592 hsa-miR-585 UGGGCGUAUCUGUAUGCUA
ENST00000376250 MI0005714 hsa-miR-922 GCAGCAGAGAAUAGGACUACGUC
ENST00000376250 MI0005763 hsa-miR-941 CACCCGGCUGUGUGCACAUGUGC
ENST00000376250 MI0005764 hsa-miR-941 CACCCGGCUGUGUGCACAUGUGC
ENST00000376250 MI0005765 hsa-miR-941 CACCCGGCUGUGUGCACAUGUGC
ENST00000376250 MI0005766 hsa-miR-941 CACCCGGCUGUGUGCACAUGUGC
ENST00000376250 MI0000388 mmu-miR-290-5p ACUCAAACUAUGGGGGCACUUU
ENST00000376250 MI0000390 mmu-miR-292-5p ACUCAAACUGGGGGCUCUUUUG
ENST00000376250 MI0000630 mmu-miR-344 UGAUCUAGCCAAAGCCUGACUGU
ENST00000376250 MI0005495 mmu-miR-344 UGAUCUAGCCAAAGCCUGACUGU
ENST00000376250 MI0001526 mmu-miR-434-5p GCUCGACUCAUGGUUUGAACCA
ENST00000376250 MI0002399 mmu-miR-464 UACCAAGUUUAUUCUGUGAGAUA
ENST00000376250 MI0004686 mmu-miR-702 UGCCCACCCUUUACCCCGCUC
ENST00000376250 MI0004707 mmu-miR-718 CUUCCGCCCGGCCGGGUGUCG
ENST00000376250 MI0005548 mmu-miR-878-3p GCAUGACACCACACUGGGUAGA
ENST00000376250 MI0005548 mmu-miR-878-5p UAUCUAGUUGGAUGUCAAGACA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
pirinixic acid
  • pirinixic acid results in decreased expression of A2LD1 mRNA
17426115

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Edema inferred via pirinixic acid 12083418
Liver Neoplasms inferred via pirinixic acid 15890375

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  2. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932