CBS | GeneID:875 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 875 Official Symbol CBS
Locus N/A Gene Type protein-coding
Synonyms HIP4
Full Name cystathionine-beta-synthase
Description cystathionine-beta-synthase
Chromosome 21q22.3
Also Known As OTTHUMP00000109416; OTTHUMP00000109418; beta-thionase; cystathionine beta-synthase; methylcysteine synthase; serine sulfhydrase
Summary The protein encoded by this gene acts as a homotetramer to catalyze the conversion of homocysteine to cystathionine, the first step in the transsulfuration pathway. The encoded protein is allosterically activated by adenosyl-methionine and uses pyridoxal phosphate as a cofactor. Defects in this gene can cause cystathionine beta-synthase deficiency (CBSD), which can lead to homocystinuria. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 37258

ID Symbol Protein Species
GeneID:875 CBS NP_000062.1 Homo sapiens
GeneID:12411 Cbs NP_835742.1 Mus musculus
GeneID:24250 Cbs NP_036654.1 Rattus norvegicus
GeneID:33081 CG1753 NP_728384.1 Drosophila melanogaster
GeneID:266987 cbs NP_001014367.2 Danio rerio
GeneID:418545 CBS XP_416752.2 Gallus gallus
GeneID:514525 CBS XP_592392.2 Bos taurus
GeneID:550524 zgc:110199 NP_001104702.1 Danio rerio
GeneID:611071 CBS XP_853796.1 Canis lupus familiaris
GeneID:736626 CBS XP_001142443.1 Pan troglodytes
GeneID:853059 CYS4 NP_011671.1 Saccharomyces cerevisiae
GeneID:1272101 AgaP_AGAP000162 XP_310977.2 Anopheles gambiae
GeneID:2683304 MGG_07384 XP_367473.2 Magnaporthe grisea
GeneID:2710843 NCU08216.1 XP_328922.1 Neurospora crassa
GeneID:2895241 KLLA0F09317g XP_455504.1 Kluyveromyces lactis
GeneID:4340140 Os06g0149700 NP_001056819.1 Oryza sativa
GeneID:4340142 Os06g0149900 NP_001056820.1 Oryza sativa
GeneID:4341320 Os06g0564400 NP_001057882.1 Oryza sativa
GeneID:4341321 Os06g0564500 NP_001057884.1 Oryza sativa
GeneID:4341322 Os06g0564700 NP_001057885.1 Oryza sativa
GeneID:4622976 AGOS_AGR012C NP_986677.1 Eremothecium gossypii

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab54883 CBS antibody (ab54883); Mouse monoclonal to CBS
2 acris AP17189PU-N CBS (Center); antibody Ab
3 scbt CBS CBS Antibody / CBS Antibodies;
4 sigma HPA001223 Anti-CBS antibody produced in rabbit ;

Exon, Intron and UTRs

Exon, Intron and UTRs of CBS Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of CBS Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0005829 Component cytosol
GO:0005730 Component nucleolus
GO:0005634 Component nucleus
GO:0004122 Function cystathionine beta-synthase activity
GO:0005506 Function iron ion binding
GO:0016829 Function lyase activity
GO:0046872 Function metal ion binding
GO:0030170 Function pyridoxal phosphate binding
GO:0008652 Process cellular amino acid biosynthetic process
GO:0006535 Process cysteine biosynthetic process from serine
GO:0019343 Process cysteine biosynthetic process via cystathionine
GO:0008152 Process metabolic process
GO:0043506 Process regulation of JUN kinase activity

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_000071  UCSC Browser NP_000062 P35520   B2R993  

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000352178 MI0000060 hsa-let-7a* CUAUACAAUCUACUGUCUUUC
ENST00000352178 MI0000062 hsa-let-7a* CUAUACAAUCUACUGUCUUUC
ENST00000352178 MI0000063 hsa-let-7b* CUAUACAACCUACUGCCUUCCC
ENST00000352178 MI0000065 hsa-let-7d* CUAUACGACCUGCUGCCUUUCU
ENST00000352178 MI0000066 hsa-let-7e* CUAUACGGCCUCCUAGCUUUCC
ENST00000352178 MI0000067 hsa-let-7f-1* CUAUACAAUCUAUUGCCUUCCC
ENST00000352178 MI0000434 hsa-let-7i* CUGCGCAAGCUACUGCCUUGCU
ENST00000352178 MI0000102 hsa-miR-100 AACCCGUAGAUCCGAACUUGUG
ENST00000352178 MI0000111 hsa-miR-105 UCAAAUGCUCAGACUCCUGUGGU
ENST00000352178 MI0000112 hsa-miR-105 UCAAAUGCUCAGACUCCUGUGGU
ENST00000352178 MI0000111 hsa-miR-105* ACGGAUGUUUGAGCAUGUGCUA
ENST00000352178 MI0000112 hsa-miR-105* ACGGAUGUUUGAGCAUGUGCUA
ENST00000352178 MI0000469 hsa-miR-125a-3p ACAGGUGAGGUUCUUGGGAGCC
ENST00000352178 MI0000458 hsa-miR-142-5p CAUAAAGUAGAAAGCACUACU
ENST00000352178 MI0000480 hsa-miR-154 UAGGUUAUCCGUGUUGCCUUCG
ENST00000352178 MI0000115 hsa-miR-16-2* CCAAUAUUACUGUGCUGCUUUA
ENST00000352178 MI0000489 hsa-miR-195* CCAAUAUUGGCUGUGCUGCUCC
ENST00000352178 MI0000240 hsa-miR-198 GGUCCAGAGGGGAGAUAGGUUC
ENST00000352178 MI0000242 hsa-miR-199a-5p CCCAGUGUUCAGACUACCUGUUC
ENST00000352178 MI0000281 hsa-miR-199a-5p CCCAGUGUUCAGACUACCUGUUC
ENST00000352178 MI0000282 hsa-miR-199b-5p CCCAGUGUUUAGACUAUCUGUUC
ENST00000352178 MI0000737 hsa-miR-200a* CAUCUUACCGGACAGUGCUGGA
ENST00000352178 MI0000342 hsa-miR-200b* CAUCUUACUGGGCAGCAUUGGA
ENST00000352178 MI0000283 hsa-miR-203 GUGAAAUGUUUAGGACCACUAG
ENST00000352178 MI0000080 hsa-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENST00000352178 MI0000081 hsa-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENST00000352178 MI0000091 hsa-miR-33a* CAAUGUUUCCACAGUGCAUCAC
ENST00000352178 MI0000779 hsa-miR-371-3p AAGUGCCGCCAUCUUUUGAGUGU
ENST00000352178 MI0000783 hsa-miR-375 UUUGUUCGUUCGGCUCGCGUGA
ENST00000352178 MI0000786 hsa-miR-378 ACUGGACUUGGAGUCAGAAGG
ENST00000352178 MI0003675 hsa-miR-411 UAGUAGACCGUAUAGCGUACG
ENST00000352178 MI0001444 hsa-miR-422a ACUGGACUUAGGGUCAGAAGGC
ENST00000352178 MI0002467 hsa-miR-483-5p AAGACGGGAGGAAAGAAGGGAG
ENST00000352178 MI0003125 hsa-miR-490-3p CAACCUGGAGGACUCCAUGCUG
ENST00000352178 MI0003134 hsa-miR-494 UGAAACAUACACGGGAAACCUC
ENST00000352178 MI0003140 hsa-miR-512-5p CACUCAGCCUUGAGGGCACUUUC
ENST00000352178 MI0003141 hsa-miR-512-5p CACUCAGCCUUGAGGGCACUUUC
ENST00000352178 MI0003153 hsa-miR-523 GAACGCGCUUCCCUAUAGAGGGU
ENST00000352178 MI0003686 hsa-miR-542-3p UGUGACAGAUUGAUAACUGAAA
ENST00000352178 MI0005565 hsa-miR-543 AAACAUUCGCGGUGCACUUCUU
ENST00000352178 MI0003668 hsa-miR-548d-3p CAAAAACCACAGUUUCUUUUGC
ENST00000352178 MI0003671 hsa-miR-548d-3p CAAAAACCACAGUUUCUUUUGC
ENST00000352178 MI0003579 hsa-miR-572 GUCCGCUCGGCGGUGGCCCA
ENST00000352178 MI0003588 hsa-miR-581 UCUUGUGUUCUCUAGAUCAGU
ENST00000352178 MI0003621 hsa-miR-608 AGGGGUGGUGUUGGGACAGCUCCGU
ENST00000352178 MI0003629 hsa-miR-616 AGUCAUUGGAGGGUUUGAGCAG
ENST00000352178 MI0003664 hsa-miR-649 AAACCUGUGUUGUUCAAGAGUC
ENST00000352178 MI0005116 hsa-miR-765 UGGAGGAGAAGGAAGGUGAUG
ENST00000352178 MI0005542 hsa-miR-876-5p UGGAUUUCUUUGUGAAUCACCA
ENST00000352178 MI0005534 hsa-miR-891b UGCAACUUACCUGAGUCAUUGA
ENST00000352178 MI0005528 hsa-miR-892a CACUGUGUCCUUUCUGCGUAG
ENST00000352178 MI0000466 hsa-miR-9 UCUUUGGUUAUCUAGCUGUAUGA
ENST00000352178 MI0000467 hsa-miR-9 UCUUUGGUUAUCUAGCUGUAUGA
ENST00000352178 MI0000468 hsa-miR-9 UCUUUGGUUAUCUAGCUGUAUGA
ENST00000352178 MI0005714 hsa-miR-922 GCAGCAGAGAAUAGGACUACGUC
ENST00000352178 MI0005767 hsa-miR-942 UCUUCUCUGUUUUGGCCAUGUG
ENST00000352178 MI0002637 mml-miR-189 GUGCCUACUGAGCUGAUAUCAGU
ENST00000352178 MI0000250 mmu-miR-207 GCUUCUCCUGGCUCUCCUCCCUC
ENST00000352178 MI0000388 mmu-miR-290-3p AAAGUGCCGCCUAGUUUUAAGCCC
ENST00000352178 MI0000388 mmu-miR-290-5p ACUCAAACUAUGGGGGCACUUU
ENST00000352178 MI0000390 mmu-miR-292-3p AAAGUGCCGCCAGGUUUUGAGUGU
ENST00000352178 MI0000390 mmu-miR-292-5p ACUCAAACUGGGGGCUCUUUUG
ENST00000352178 MI0000391 mmu-miR-293 AGUGCCGCAGAGUUUGUAGUGU
ENST00000352178 MI0000625 mmu-miR-341 UCGGUCGAUCGGUCGGUCGGU
ENST00000352178 MI0000643 mmu-miR-351 UCCCUGAGGAGCCCUUUGAGCCUG
ENST00000352178 MI0002402 mmu-miR-467a UAAGUGCCUGCAUGUAUAUGCG
ENST00000352178 MI0004671 mmu-miR-467b GUAAGUGCCUGCAUGUAUAUG
ENST00000352178 MI0004635 mmu-miR-678 GUCUCGGUGCAAGGACUGGAGG
ENST00000352178 MI0004643 mmu-miR-681 CAGCCUCGCUGGCAGGCAGCU
ENST00000352178 MI0004650 mmu-miR-686 AUUGCUUCCCAGACGGUGAAGA
ENST00000352178 MI0005470 mmu-miR-743b-5p UGUUCAGACUGGUGUCCAUCA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Acetaminophen
  • Acetaminophen affects the expression of CBS mRNA
17562736
Clofibric Acid
  • [Diethylnitrosamine co-treated with Clofibric Acid] affects the expression of CBS mRNA
17602206
Diethylnitrosamine
  • [Diethylnitrosamine co-treated with Clofibric Acid] affects the expression of CBS mRNA
17602206
Dihydrotestosterone
  • Dihydrotestosterone does not affect the expression of CBS mRNA
  • Dihydrotestosterone results in decreased expression of CBS protein
17854288
Glutathione
  • CBS gene mutant form results in decreased abundance of Glutathione
15016621
Indomethacin
  • Indomethacin results in increased expression of CBS mRNA
17401462
Methapyrilene
  • Methapyrilene results in decreased expression of CBS mRNA
16393664
nitrosobenzylmethylamine
  • nitrosobenzylmethylamine results in decreased expression of CBS mRNA
17616710
tert-Butylhydroperoxide
  • tert-Butylhydroperoxide results in decreased expression of CBS mRNA
15336504

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Cardiovascular Diseases marker 16791140
Homocystinuria marker
Lymphoma, Non-Hodgkin marker 17119116
Malnutrition marker 16709328
Esophageal Neoplasms inferred via nitrosobenzylmethylamine 16805852, 15547733, 16510608, 16704527, 15878914, 15547721, 15623463, 15150132, 15264214
Stomach Neoplasms inferred via nitrosobenzylmethylamine 17575124, 12958204
Liver Neoplasms inferred via Methapyrilene 15890375
Adenoma inferred via Indomethacin 11497255
Alzheimer Disease inferred via Indomethacin 15579461
Breast Neoplasms inferred via Indomethacin 17401462
Carcinoma, Hepatocellular inferred via Indomethacin 16391822
Colonic Neoplasms inferred via Indomethacin 11260862, 15786552, 15963497
Colorectal Neoplasms inferred via Indomethacin 18059344, 17054584, 12606626
Duodenal Ulcer inferred via Indomethacin 17045617, 16699067, 17202747
Edema inferred via Indomethacin 8985016
Enteritis inferred via Indomethacin 16328016
Esophageal Neoplasms inferred via Indomethacin 11005569
Glioblastoma inferred via Indomethacin 12870263
Hyperlipidemias inferred via Indomethacin 17546600
Ileal Diseases inferred via Indomethacin 10574470
Intestinal Diseases inferred via Indomethacin 15610444, 15831440, 10210152, 17329856
Jejunal Diseases inferred via Indomethacin 10574470
Leukemia, Myelogenous, Chronic, BCR-ABL Positive inferred via Indomethacin 10785260
Leukemia, Myeloid, Acute inferred via Indomethacin 18360721
Lung Neoplasms inferred via Indomethacin 11497255
Pain inferred via Indomethacin 17440234
Stomach Diseases inferred via Indomethacin 17207306
Stomach Ulcer inferred via Indomethacin 16934674, 15104355, 12077510, 17654042, 12467913, 18299717, 10878458
Ulcer inferred via Indomethacin 10574470
Carcinoma, Squamous Cell inferred via Glutathione 17015178
Adenoma inferred via Diethylnitrosamine 10737359
Carcinoma, Hepatocellular inferred via Diethylnitrosamine 16878318, 10737359, 17428255, 11831363, 10672840
Liver Neoplasms inferred via Diethylnitrosamine 2422723, 16942905, 15885732, 10737359, 18648771, 12112319
Liver Neoplasms, Experimental inferred via Diethylnitrosamine 16267830, 3124819, 16842330
Liver Neoplasms inferred via Clofibric Acid 17602206
Hepatitis, Toxic inferred via Acetaminophen 2444490, 17522070, 14986274, 16227642, 15968718, 16177239, 17562736, 16081117
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
C17orf28 CBS / C17orf28 Two-hybrid Rual JF (2005)
C6orf55 CBS / C6orf55 Two-hybrid Rual JF (2005)
CBS CBS / CBS Affinity Capture-Western Rual JF (2005)
CBS CBS / CBS Co-crystal Structure Janosik M (2001)
CBS CBS / CBS Co-crystal Structure Meier M (2001)
CBS CBS / CBS Two-hybrid Rual JF (2005)
FXR2 CBS / FXR2 Two-hybrid Rual JF (2005)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Velez DR, et al. (2009) "Spontaneous preterm birth in African Americans is associated with infection and inflammatory response gene variants." Am J Obstet Gynecol. 200(2):209.e1-209.27. PMID:19019335
  2. [ + ] Menon R, et al. (2009) "Racial disparity in pathophysiologic pathways of preterm birth based on genetic variants." Reprod Biol Endocrinol. 7(1):62. PMID:19527514
  3. [ + ] Luo D, et al. (2009) "[Levels of homocysteine and polymorphisms of homocysteine metabolism-related enzymes in patients with type 2 diabetes mellitus and coronary heart disease]" Wei Sheng Yan Jiu. 38(1):39-42. PMID:19267073
  4. [ + ] Belew MS, et al. (2009) "Kinetic characterization of recombinant human cystathionine beta-synthase purified from E. coli." Protein Expr Purif. 64(2):139-145. PMID:19010420
  5. [ + ] Sawula W, et al. (2009) "Homocysteine level and metabolism in ischemic stroke in the population of Northern Poland." Clin Biochem. 42(6):442-447. PMID:19166826
  6. [ + ] Dutta S, et al. (2009) "Correlation between cystathionine beta synthase gene polymorphisms, plasma homocysteine and idiopathic mental retardation in Indian individuals from Kolkata." Neurosci Lett. 453(3):214-218. PMID:19429038
  7. [ + ] Pridgeon JW, et al. (2009) "Proteomic analysis reveals Hrs ubiquitin-interacting motif-mediated ubiquitin signaling in multiple cellular processes." FEBS J. 276(1):118-131. PMID:19019082
  8. [ + ] Boyles AL, et al. (2009) "Oral facial clefts and gene polymorphisms in metabolism of folate/one-carbon and vitamin A: a pathway-wide association study." Genet Epidemiol. 33(3):247-255. PMID:19048631
  9. [ + ] Singh LR, et al. (2009) "Functional rescue of mutant human cystathionine beta-synthase by manipulation of Hsp26 and Hsp70 levels in Saccharomyces cerevisiae." J Biol Chem. 284(7):4238-4245. PMID:19074437
  10. [ + ] Zschocke J, et al. (2009) "Molecular neonatal screening for homocystinuria in the Qatari population." Hum Mutat. 30(6):1021-1022. PMID:19370759
  11. [ + ] Franke B, et al. (2009) "An association study of 45 folate-related genes in spina bifida: Involvement of cubilin (CUBN) and tRNA aspartic acid methyltransferase 1 (TRDMT1)." Birth Defects Res A Clin Mol Teratol. 85(3):216-226. PMID:19161160
  12. [ + ] Hosgood HD 3rd, et al. (2008) "Pathway-based evaluation of 380 candidate genes and lung cancer susceptibility suggests the importance of the cell cycle pathway." Carcinogenesis. 29(10):1938-1943. PMID:18676680
  13. [ + ] Yang QH, et al. (2008) "Prevalence and effects of gene-gene and gene-nutrient interactions on serum folate and serum total homocysteine concentrations in the United States: findings from the third National Health and Nutrition Examination Survey DNA Bank." Am J Clin Nutr. 88(1):232-246. PMID:18614746
  14. [ + ] Meyer K, et al. (2008) "MALDI-TOF MS Genotyping of Polymorphisms Related to 1-Carbon Metabolism Using Common and Mass-Modified Terminators." Clin Chem. ():. PMID:18988749
  15. [ + ] Jakubowski H, et al. (2008) "Mutations in cystathionine beta-synthase or methylenetetrahydrofolate reductase gene increase N-homocysteinylated protein levels in humans." FASEB J. 22(12):4071-4076. PMID:18708589
  16. [ + ] Belkahla R, et al. (2008) "[Effect of polymorphisms on key enzymes in homocysteine metabolism, on plasma homocysteine level and on coronary artery-disease risk in a Tunisian population]" Ann Cardiol Angeiol (Paris). 57(4):219-224. PMID:18620331
  17. [ + ] Zhu W, et al. (2008) "[CBS gene variations and serum homocysteine level associated with congenital heart defects]" Wei Sheng Yan Jiu. 37(4):463-467. PMID:18839533
  18. [ + ] Maitland-van der Zee AH, et al. (2008) "Interactions between the single nucleotide polymorphisms in the homocysteine pathway (MTHFR 677C>T, MTHFR 1298 A>C, and CBSins) and the efficacy of HMG-CoA reductase inhibitors in preventing cardiovascular disease in high-risk patients of hypertension: the GenHAT study." Pharmacogenet Genomics. 18(8):651-656. PMID:18622257
  19. [ + ] Chang MH, et al. (2008) "Prevalence in the United States of Selected Candidate Gene Variants: Third National Health and Nutrition Examination Survey, 1991-1994." Am J Epidemiol. ():. PMID:18936436
  20. [ + ] Ott N, et al. (2008) "Polymorphisms in methionine synthase (A2756G) and cystathionine beta-synthase (844ins68) and susceptibility to carcinomas of the upper gastrointestinal tract." J Cancer Res Clin Oncol. 134(3):405-410. PMID:17726616
  21. [ + ] Summers CM, et al. (2008) "Functional polymorphisms of folate-metabolizing enzymes in relation to homocysteine concentrations in systemic lupus erythematosus." J Rheumatol. 35(11):2179-2186. PMID:18785313
  22. [ + ] Giusti B, et al. (2008) "Genetic analysis of 56 polymorphisms in 17 genes involved in methionine metabolism in patients with abdominal aortic aneurysm." J Med Genet. 45(11):721-730. PMID:18635682
  23. [ + ] Gibson CS, et al. (2008) "Candidate genes and cerebral palsy: a population-based study." Pediatrics. 122(5):1079-1085. PMID:18977990
  24. [ + ] Wang SS, et al. (2008) "Polymorphisms in DNA repair and one-carbon metabolism genes and overall survival in diffuse large B-cell lymphoma and follicular lymphoma." Leukemia. ():. PMID:18830263
  25. [ + ] Giusti B, et al. (2008) "High-throughput multiplex single-nucleotide polymorphism (SNP) analysis in genes involved in methionine metabolism." Biochem Genet. 46(7-8):406-423. PMID:18427977
  26. [ + ] Janosik M, et al. (2008) "Birth Prevalence of Homocystinuria in Central Europe: Frequency and Pathogenicity of Mutation c.1105C>T (p.R369C) in the Cystathionine Beta-Synthase Gene." J Pediatr. ():. PMID:18950795
  27. [ + ] Barbe L, et al. (2008) "Toward a confocal subcellular atlas of the human proteome." Mol Cell Proteomics. 7(3):499-508. PMID:18029348
  28. [ + ] Frank N, et al. (2008) "Purification and characterization of the wild type and truncated human cystathionine beta-synthase enzymes expressed in E. coli." Arch Biochem Biophys. 470(1):64-72. PMID:18060852
  29. [ + ] Starr JM, et al. (2008) "Oxidative stress, telomere length and biomarkers of physical aging in a cohort aged 79 years from the 1932 Scottish Mental Survey." Mech Ageing Dev. 129(12):745-751. PMID:18977241
  30. [ + ] Skibola CF, et al. (2008) "Polymorphisms in the estrogen receptor 1 and vitamin C and matrix metalloproteinase gene families are associated with susceptibility to lymphoma." PLoS ONE. 3(7):e2816. PMID:18636124
  31. [ + ] Semmler A, et al. (2008) "Polymorphisms of homocysteine metabolism are associated with intracranial aneurysms." Cerebrovasc Dis. 26(4):425-429. PMID:18799873
  32. [ + ] Stevens VL, et al. (2008) "No association of single nucleotide polymorphisms in one-carbon metabolism genes with prostate cancer risk." Cancer Epidemiol Biomarkers Prev. 17(12):3612-3614. PMID:19064578
  33. [ + ] Alessio AC, et al. (2008) "Polymorphisms in the CBS gene and homocysteine, folate and vitamin B12 levels: association with polymorphisms in the MTHFR and MTRR genes in Brazilian children." Am J Med Genet A. 146A(20):2598-2602. PMID:18792976
  34. [ + ] Boyles AL, et al. (2008) "Folate and one-carbon metabolism gene polymorphisms and their associations with oral facial clefts." Am J Med Genet A. 146A(4):440-449. PMID:18203168
  35. [ + ] Velez DR, et al. (2008) "Preterm birth in Caucasians is associated with coagulation and inflammation pathway gene variants." PLoS ONE. 3(9):e3283. PMID:18818748
  36. [ + ] Summers CM, et al. (2008) "Influence of the cystathionine beta-synthase 844ins68 and methylenetetrahydrofolate reductase 677C>T polymorphisms on folate and homocysteine concentrations." Eur J Hum Genet. 16(8):1010-1013. PMID:18398434
  37. [ + ] Carballal S, et al. (2008) "Dioxygen reactivity and heme redox potential of truncated human cystathionine beta-synthase." Biochemistry. 47(10):3194-3201. PMID:18278872
  38. [ + ] Gupta S, et al. (2008) "Cystathionine beta-synthase p.S466L mutation causes hyperhomocysteinemia in mice." Hum Mutat. 29(8):1048-1054. PMID:18454451
  39. [ + ] Semmler A, et al. (2008) "Polymorphisms of methionine metabolism and susceptibility to meningioma formation: laboratory investigation." J Neurosurg. 108(5):999-1004. PMID:18447718
  40. [ + ] Lim U, et al. (2007) "Gene-nutrient interactions among determinants of folate and one-carbon metabolism on the risk of non-Hodgkin lymphoma: NCI-SEER case-control study." Blood. 109(7):3050-3059. PMID:17119116
  41. [ + ] Lee KM, et al. (2007) "One-carbon metabolism gene polymorphisms and risk of non-Hodgkin lymphoma in Australia." Hum Genet. 122(5):525-533. PMID:17891500
  42. [ + ] Moore LE, et al. (2007) "Polymorphisms in one-carbon metabolism and trans-sulfuration pathway genes and susceptibility to bladder cancer." Int J Cancer. 120(11):2452-2458. PMID:17311259
  43. [ + ] Lissowska J, et al. (2007) "Genetic polymorphisms in the one-carbon metabolism pathway and breast cancer risk: a population-based case-control study and meta-analyses." Int J Cancer. 120(12):2696-2703. PMID:17311260
  44. [ + ] Cherney MM, et al. (2007) "Ferrous human cystathionine beta-synthase loses activity during enzyme assay due to a ligand switch process." Biochemistry. 46(45):13199-13210. PMID:17956124
  45. [ + ] Harris SE, et al. (2007) "A genetic association analysis of cognitive ability and cognitive ageing using 325 markers for 109 genes associated with oxidative stress or cognition." BMC Genet. 8():43. PMID:17601350