ABCC3 | GeneID:8714 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 8714 Official Symbol ABCC3
Locus N/A Gene Type protein-coding
Synonyms ABC31; DKFZp686E22157; EST90757; MLP2; MOAT-D; MRP3; cMOAT2
Full Name ATP-binding cassette, sub-family C (CFTR/MRP), member 3
Description ATP-binding cassette, sub-family C (CFTR/MRP), member 3
Chromosome 17q22
Also Known As ATP-binding cassette, sub-family C, member 3; canicular multispecific organic anion transporter; multidrug resistance associated protein
Summary The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. The specific function of this protein has not yet been determined; however, this protein may play a role in the transport of biliary and intestinal excretion of organic anions. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 68364

ID Symbol Protein Species
GeneID:8714 ABCC3 NP_003777.2 Homo sapiens
GeneID:76408 Abcc3 NP_083876.3 Mus musculus
GeneID:140668 Abcc3 NP_542148.1 Rattus norvegicus
GeneID:181202 mrp-4 NP_509658.1 Caenorhabditis elegans
GeneID:422099 ABCC3 XP_420102.2 Gallus gallus
GeneID:491084 ABCC3 XP_548204.2 Canis lupus familiaris
GeneID:533151 ABCC3 XP_612461.3 Bos taurus
GeneID:747938 ABCC3 XP_001158914.1 Pan troglodytes
GeneID:839921 ATMRP13 NP_174330.1 Arabidopsis thaliana
GeneID:839922 ATMRP12 NP_174331.2 Arabidopsis thaliana

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab3376 MRP3 antibody [M3II-21] (ab3376); Mouse monoclonal [M3II-21] to MRP3
2 abcam ab3375 MRP3 antibody [M3II-9] (ab3375); Mouse monoclonal [M3II-9] to MRP3
3 abcam ab49479 MRP3 antibody [DTX1] (ab49479); Mouse monoclonal [DTX1] to MRP3
4 scbt ABCC3 ABCC3 Antibody / ABCC3 Antibodies;
5 sigma M0318 Anti-MRP3 antibody produced in rabbit ;

Exon, Intron and UTRs

Exon, Intron and UTRs of ABCC3 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ABCC3 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005887 Component integral to plasma membrane
GO:0016020 Component membrane
GO:0005624 Component membrane fraction
GO:0016887 Function ATPase activity
GO:0042626 Function ATPase activity, coupled to transmembrane movement of substances
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding
GO:0008514 Function organic anion transmembrane transporter activity
GO:0005215 Function transporter activity
GO:0015722 Process canalicular bile acid transport
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001144070  UCSC Browser NP_001137542
2 NM_003786  UCSC Browser NP_003777 B2RPA9   O15438  

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000285238 MI0000108 hsa-miR-103 AGCAGCAUUGUACAGGGCUAUGA
ENST00000285238 MI0000109 hsa-miR-103 AGCAGCAUUGUACAGGGCUAUGA
ENST00000285238 MI0000114 hsa-miR-107 AGCAGCAUUGUACAGGGCUAUCA
ENST00000285238 MI0000266 hsa-miR-10a UACCCUGUAGAUCCGAAUUUGUG
ENST00000285238 MI0000267 hsa-miR-10b UACCCUGUAGAACCGAAUUUGUG
ENST00000285238 MI0000443 hsa-miR-124 UAAGGCACGCGGUGAAUGCC
ENST00000285238 MI0000444 hsa-miR-124 UAAGGCACGCGGUGAAUGCC
ENST00000285238 MI0000445 hsa-miR-124 UAAGGCACGCGGUGAAUGCC
ENST00000285238 MI0000448 hsa-miR-130a CAGUGCAAUGUUAAAAGGGCAU
ENST00000285238 MI0005544 hsa-miR-147b GUGUGCGGAAAUGCUUCUGCUA
ENST00000285238 MI0000253 hsa-miR-148a UCAGUGCACUACAGAACUUUGU
ENST00000285238 MI0000811 hsa-miR-148b UCAGUGCAUCACAGAACUUUGU
ENST00000285238 MI0000462 hsa-miR-152 UCAGUGCAUGACAGAACUUGG
ENST00000285238 MI0000438 hsa-miR-15b UAGCAGCACAUCAUGGUUUACA
ENST00000285238 MI0000270 hsa-miR-181b AACAUUCAUUGCUGUCGGUGGGU
ENST00000285238 MI0000683 hsa-miR-181b AACAUUCAUUGCUGUCGGUGGGU
ENST00000285238 MI0003139 hsa-miR-181d AACAUUCAUUGUUGUCGGUGGGU
ENST00000285238 MI0000072 hsa-miR-18a UAAGGUGCAUCUAGUGCAGAUAG
ENST00000285238 MI0001518 hsa-miR-18b UAAGGUGCAUCUAGUGCAGUUAG
ENST00000285238 MI0000234 hsa-miR-192 CUGACCUAUGAAUUGACAGCC
ENST00000285238 MI0000242 hsa-miR-199a-5p CCCAGUGUUCAGACUACCUGUUC
ENST00000285238 MI0000281 hsa-miR-199a-5p CCCAGUGUUCAGACUACCUGUUC
ENST00000285238 MI0000282 hsa-miR-199b-5p CCCAGUGUUUAGACUAUCUGUUC
ENST00000285238 MI0000073 hsa-miR-19a UGUGCAAAUCUAUGCAAAACUGA
ENST00000285238 MI0000074 hsa-miR-19b UGUGCAAAUCCAUGCAAAACUGA
ENST00000285238 MI0000075 hsa-miR-19b UGUGCAAAUCCAUGCAAAACUGA
ENST00000285238 MI0000291 hsa-miR-215 AUGACCUAUGAAUUGACAGAC
ENST00000285238 MI0000079 hsa-miR-23a* GGGGUUCCUGGGGAUGGGAUUU
ENST00000285238 MI0000080 hsa-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENST00000285238 MI0000081 hsa-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENST00000285238 MI0000738 hsa-miR-302a UAAGUGCUUCCAUGUUUUGGUGA
ENST00000285238 MI0000772 hsa-miR-302b UAAGUGCUUCCAUGUUUUAGUAG
ENST00000285238 MI0000773 hsa-miR-302c UAAGUGCUUCCAUGUUUCAGUGG
ENST00000285238 MI0000774 hsa-miR-302d UAAGUGCUUCCAUGUUUGAGUGU
ENST00000285238 MI0000815 hsa-miR-339-3p UGAGCGCCUCGACGACAGAGCCG
ENST00000285238 MI0000743 hsa-miR-34c-5p AGGCAGUGUAGUUAGCUGAUUGC
ENST00000285238 MI0000777 hsa-miR-369-3p AAUAAUACAUGGUUGAUCUUU
ENST00000285238 MI0000779 hsa-miR-371-5p ACUCAAACUGUGGGGGCACU
ENST00000285238 MI0001735 hsa-miR-409-5p AGGUUACCCGAGCAACUUUGCAU
ENST00000285238 MI0003673 hsa-miR-449b AGGCAGUGUAUUGUUAGCUGGC
ENST00000285238 MI0005531 hsa-miR-450b-3p UUGGGAUCAUUUUGCAUCCAUA
ENST00000285238 MI0003193 hsa-miR-506 UAAGGCACCCUUCUGAGUAGA
ENST00000285238 MI0003195 hsa-miR-508-5p UACUCCAGAGGGCGUCACUCAUG
ENST00000285238 MI0003149 hsa-miR-520a-5p CUCCAGAGGGAAGUACUUUCU
ENST00000285238 MI0003143 hsa-miR-520e AAAGUGCUUCCUUUUUGAGGG
ENST00000285238 MI0003146 hsa-miR-520f AAGUGCUUCCUUUUAGAGGGUU
ENST00000285238 MI0003152 hsa-miR-525-3p GAAGGCGCUUCCCUUUAGAGCG
ENST00000285238 MI0003686 hsa-miR-542-5p UCGGGGAUCAUCAUGUCACGAGA
ENST00000285238 MI0003575 hsa-miR-551b GCGACCCAUACUUGGUUUCAG
ENST00000285238 MI0003589 hsa-miR-582-3p UAACUGGUUGAACAACUGAACC
ENST00000285238 MI0003589 hsa-miR-582-5p UUACAGUUGUUCAACCAGUUACU
ENST00000285238 MI0003599 hsa-miR-589 UGAGAACCACGUCUGCUCUGAG
ENST00000285238 MI0003603 hsa-miR-591 AGACCAUGGGUUCUCAUUGU
ENST00000285238 MI0003621 hsa-miR-608 AGGGGUGGUGUUGGGACAGCUCCGU
ENST00000285238 MI0003639 hsa-miR-625 AGGGGGAAAGUUCUAUAGUCC
ENST00000285238 MI0003640 hsa-miR-626 AGCUGUCUGAAAAUGUCUU
ENST00000285238 MI0003653 hsa-miR-638 AGGGAUCGCGGGCGGGUGGCGGCCU
ENST00000285238 MI0003655 hsa-miR-640 AUGAUCCAGGAACCUGCCUCU
ENST00000285238 MI0003661 hsa-miR-646 AAGCAGCUGCCUCUGAGGC
ENST00000285238 MI0003663 hsa-miR-648 AAGUGUGCAGGGCACUGGU
ENST00000285238 MI0003757 hsa-miR-758 UUUGUGACCUGGUCCACUAACC
ENST00000285238 MI0005538 hsa-miR-892b CACUGGCUCCUUUCUGGGUAGA
ENST00000285238 MI0005757 hsa-miR-935 CCAGUUACCGCUUCCGCUACCGC
ENST00000285238 MI0000244 mmu-miR-201 UACUCAGUAAGGCAUUGUUCUU
ENST00000285238 MI0000388 mmu-miR-290-5p ACUCAAACUAUGGGGGCACUUU
ENST00000285238 MI0000390 mmu-miR-292-3p AAAGUGCCGCCAGGUUUUGAGUGU
ENST00000285238 MI0000390 mmu-miR-292-5p ACUCAAACUGGGGGCUCUUUUG
ENST00000285238 MI0002399 mmu-miR-464 UACCAAGUUUAUUCUGUGAGAUA
ENST00000285238 MI0004673 mmu-miR-669c AUAGUUGUGUGUGGAUGUGUGU
ENST00000285238 MI0004652 mmu-miR-687 CUAUCCUGGAAUGCAGCAAUGA
ENST00000285238 MI0004659 mmu-miR-691 AUUCCUGAAGAGAGGCAGAAAA
ENST00000285238 MI0004554 mmu-miR-759 GCAGAGUGCAAACAAUUUUGAC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
1,4-bis(2-(3,5-dichloropyridyloxy))benzene
  • [1,4-bis(2-(3,5-dichloropyridyloxy))benzene results in increased activity of NR1I3 protein] which results in increased expression of ABCC3 mRNA
15833929
1,4-bis(2-(3,5-dichloropyridyloxy))benzene
  • 1,4-bis(2-(3,5-dichloropyridyloxy))benzene results in increased expression of ABCC3 mRNA
15986414, 15833929
1,4-bis(2-(3,5-dichloropyridyloxy))benzene
  • 1,4-bis(2-(3,5-dichloropyridyloxy))benzene results in increased expression of ABCC3 protein
15986414
15-deoxy-delta(12,14)-prostaglandin J2
  • ABCC3 protein affects the export of 15-deoxy-delta(12,14)-prostaglandin J2 analog
14979731
1-Naphthylisothiocyanate
  • 1-Naphthylisothiocyanate results in increased expression of ABCC3 mRNA
17522070, 14623915
2-Acetylaminofluorene
  • 2-Acetylaminofluorene results in increased expression of ABCC3 mRNA
12801967
2-Acetylaminofluorene
  • 2-Acetylaminofluorene results in increased expression of ABCC3 mRNA
  • 2-Acetylaminofluorene results in increased expression of ABCC3 protein
10691972
3,4,5,3',4'-pentachlorobiphenyl
  • [3,4,5,3',4'-pentachlorobiphenyl binds to AHR protein] which results in increased expression of ABCC3 mRNA
  • 3,4,5,3',4'-pentachlorobiphenyl results in increased expression of ABCC3 mRNA
15833929
4-phenylenediamine
  • 4-phenylenediamine results in increased expression of ABCC3 mRNA
16314067
5-carboxyfluorescein diacetate
  • Cyclosporine inhibits the reaction [ABCC3 protein affects the export of 5-carboxyfluorescein diacetate]
  • Indomethacin inhibits the reaction [ABCC3 protein affects the export of 5-carboxyfluorescein diacetate]
  • Verapamil inhibits the reaction [ABCC3 protein affects the export of 5-carboxyfluorescein diacetate]
16636798
Acetaminophen
  • Acetaminophen results in increased expression of ABCC3 protein
16177239
Acetaminophen
  • Acetaminophen results in increased expression of ABCC3 mRNA
15496496
Acetaminophen
  • Acetaminophen results in increased expression of ABCC3 mRNA
17522070
acetaminophen glucuronide
  • Ethinyl Estradiol promotes the reaction [ABCC3 protein results in increased secretion of acetaminophen glucuronide]
16554369
acetaminophen glucuronide
  • acetaminophen glucuronide results in increased activity of ABCC3 protein
17569508
alitretinoin
  • alitretinoin results in increased expression of ABCC3 mRNA
15824121
allyl sulfide
  • [allyl sulfide results in increased activity of NR1I3 protein] which results in increased expression of ABCC3 mRNA
  • allyl sulfide results in increased expression of ABCC3 mRNA
15833929
alpha-hexachlorocyclohexane
  • alpha-hexachlorocyclohexane results in increased expression of ABCC3 mRNA
17785943
artemisinine
  • artemisinine inhibits the reaction [Simvastatin results in increased nitrosation of ABCC3 protein]
18463201
atorvastatin
  • atorvastatin results in increased expression of ABCC3 mRNA
  • atorvastatin results in increased expression of ABCC3 protein
15986414
beta-Naphthoflavone
  • [beta-Naphthoflavone binds to AHR protein] which results in increased expression of ABCC3 mRNA
  • beta-Naphthoflavone results in increased expression of ABCC3 mRNA
15833929
Bile Acids and Salts
  • Bile Acids and Salts results in increased activity of ABCC3 protein
17569508
Bile Acids and Salts
  • ABCC3 protein affects the transport of Bile Acids and Salts
12663868
Bile Acids and Salts
  • Bile Acids and Salts results in increased expression of ABCC3 mRNA
12809945
Bile Acids and Salts
  • Bile Acids and Salts inhibits the reaction [ABCC3 protein affects the transport of estradiol-17 beta-glucuronide]
12704183
Butylated Hydroxyanisole
  • [Butylated Hydroxyanisole results in increased activity of NFE2L2 protein] which results in increased expression of ABCC3 mRNA
  • Butylated Hydroxyanisole results in increased expression of ABCC3 mRNA
15833929
Cacodylic Acid
  • Cacodylic Acid results in increased expression of ABCC3 mRNA
  • Cacodylic Acid results in increased expression of ABCC3 protein
16436460
calcein AM
  • ABCC3 protein affects the transport of calcein AM
  • Dexamethasone promotes the reaction [ABCC3 protein affects the transport of calcein AM]
  • Hydrocortisone promotes the reaction [ABCC3 protein affects the transport of calcein AM]
  • Prednisone promotes the reaction [ABCC3 protein affects the transport of calcein AM]
15979871
calcein AM
  • Glutathione promotes the reaction [ABCC3 protein affects the transport of calcein AM]
15210835
Calcitriol
  • Calcitriol results in increased expression of ABCC3 mRNA
  • Calcitriol results in increased expression of ABCC3 mRNA
15824121
Carbon Tetrachloride
  • Carbon Tetrachloride results in decreased expression of ABCC3 protein
16177239
Carbon Tetrachloride
  • Carbon Tetrachloride results in increased expression of ABCC3 mRNA
15496496
Carbon Tetrachloride
  • Carbon Tetrachloride results in increased expression of ABCC3 mRNA
17522070
Chloroform
  • Chloroform results in increased expression of ABCC3 mRNA
17522070
Cholates
  • Cholates results in increased activity of ABCC3 protein
17569508
Cholic Acid
  • Cholic Acid results in increased expression of ABCC3 mRNA
12971955
ciprofibrate
  • [ciprofibrate binds to PPARA protein] which results in increased expression of ABCC3 mRNA
  • ciprofibrate results in increased expression of ABCC3 mRNA
15833929
Clofibrate
  • [Clofibrate binds to PPARA protein] which results in increased expression of ABCC3 mRNA
  • Clofibrate results in increased expression of ABCC3 mRNA
15833929
Clofibric Acid
  • Clofibric Acid does not affect the expression of ABCC3 protein
15908472
Colchicine
  • Colchicine affects the localization of ABCC3 protein
12702492
Cycloheximide
  • Cycloheximide results in increased expression of ABCC3 mRNA
  • [Cycloheximide co-treated with Estradiol] results in increased expression of ABCC3 mRNA
15072547
Cyclosporine
  • Cyclosporine inhibits the reaction [ABCC3 protein affects the export of 5-carboxyfluorescein diacetate]
16636798
Deoxycholic Acid
  • Deoxycholic Acid results in increased activity of ABCC3 protein
17569508
Dexamethasone
  • Dexamethasone results in increased expression of ABCC3 protein
15908472
Dexamethasone
  • Dexamethasone results in decreased expression of ABCC3 mRNA
17522070, 15102944
Dexamethasone
  • Dexamethasone inhibits the reaction [Lipopolysaccharides results in increased expression of ABCC3 mRNA]
15205389
Dexamethasone
  • Dexamethasone promotes the reaction [ABCC3 protein affects the transport of calcein AM]
  • Dexamethasone results in increased activity of ABCC3 protein
  • Dexamethasone results in increased expression of ABCC3 mRNA
  • Dexamethasone results in increased expression of ABCC3 protein
15979871
Dexamethasone
  • Dexamethasone does not affect the expression of ABCC3 protein
15258109
Dexamethasone
  • Dexamethasone affects the expression of ABCC3 mRNA
15102944
Dexamethasone
  • Dexamethasone does not affect the expression of ABCC3 mRNA
12429353
Diethylhexyl Phthalate
  • [Diethylhexyl Phthalate binds to PPARA protein] which results in increased expression of ABCC3 mRNA
  • Diethylhexyl Phthalate results in increased expression of ABCC3 mRNA
15833929
Diethylnitrosamine
  • [Diethylnitrosamine co-treated with Piperonyl Butoxide] results in increased expression of ABCC3 mRNA
18648771
Dimethylnitrosamine
  • Dimethylnitrosamine results in increased expression of ABCC3 mRNA
17547211
Diosgenin
  • Diosgenin results in increased expression of ABCC3 mRNA
  • [Ethinyl Estradiol co-treated with Diosgenin] results in increased expression of ABCC3 mRNA
16105132
Doxorubicin
  • Doxorubicin results in increased nitrosation of ABCC3 protein
  • Simvastatin promotes the reaction [Doxorubicin results in increased nitrosation of ABCC3 protein]
18463201
Doxorubicin
  • ABCC3 protein results in chemical resistance to Doxorubicin
15901850, 15884115, 15695394
Erythromycin Estolate
  • Erythromycin Estolate results in increased expression of ABCC3 mRNA
17522070
Estradiol
  • Estradiol results in decreased expression of ABCC3 mRNA
  • [Cycloheximide co-treated with Estradiol] results in increased expression of ABCC3 mRNA
15072547
Estradiol
  • [Progesterone co-treated with Estradiol] results in decreased expression of ABCC3 mRNA
17404688
estradiol-17 beta-glucuronide
  • estradiol-17 beta-glucuronide results in increased activity of ABCC3 protein
17569508
estradiol-17 beta-glucuronide
  • ABCC3 protein affects the transport of estradiol-17 beta-glucuronide
  • Bile Acids and Salts inhibits the reaction [ABCC3 protein affects the transport of estradiol-17 beta-glucuronide]
  • Furosemide inhibits the reaction [ABCC3 protein affects the transport of estradiol-17 beta-glucuronide]
  • Indomethacin inhibits the reaction [ABCC3 protein affects the transport of estradiol-17 beta-glucuronide]
  • Probenecid inhibits the reaction [ABCC3 protein affects the transport of estradiol-17 beta-glucuronide]
12704183
estradiol-17 beta-glucuronide
  • Ethinyl Estradiol metabolite promotes the reaction [ABCC3 protein results in increased uptake of estradiol-17 beta-glucuronide]
14722317
Ethanol
  • Ethanol results in increased expression of ABCC3 mRNA
15353170
Ethinyl Estradiol
  • Ethinyl Estradiol results in increased expression of ABCC3 mRNA
  • [Ethinyl Estradiol co-treated with Diosgenin] results in increased expression of ABCC3 mRNA
16105132
Ethinyl Estradiol
  • ABCC3 protein results in increased uptake of Ethinyl Estradiol metabolite
  • Ethinyl Estradiol metabolite promotes the reaction [ABCC3 protein results in increased uptake of estradiol-17 beta-glucuronide]
14722317
Ethinyl Estradiol
  • Ethinyl Estradiol affects the expression of ABCC3 mRNA
17555576
Ethinyl Estradiol
  • Ethinyl Estradiol promotes the reaction [ABCC3 protein results in increased secretion of acetaminophen glucuronide]
  • Ethinyl Estradiol results in increased expression of ABCC3 protein
16554369
ethinyl estradiol glucuronide
  • ethinyl estradiol glucuronide results in increased activity of ABCC3 protein
17569508
Ethoxyquin
  • [Ethoxyquin results in increased activity of NFE2L2 protein] which results in increased expression of ABCC3 mRNA
  • Ethoxyquin results in increased expression of ABCC3 mRNA
15833929
Etoposide
  • ABCC3 protein results in chemical resistance to Etoposide
15884115
Flavonoids
  • Flavonoids results in increased expression of ABCC3 mRNA
18035473
fulvestrant
  • fulvestrant results in increased expression of ABCC3 mRNA
15072547
Furosemide
  • Furosemide inhibits the reaction [ABCC3 protein affects the transport of estradiol-17 beta-glucuronide]
12704183
Glutathione
  • Glutathione promotes the reaction [ABCC3 protein affects the transport of calcein AM]
15210835
GW 4064
  • GW 4064 does not affect the expression of ABCC3 mRNA
14623915
Hydrocortisone
  • Hydrocortisone promotes the reaction [ABCC3 protein affects the transport of calcein AM]
  • Hydrocortisone results in increased activity of ABCC3 protein
  • Hydrocortisone results in increased expression of ABCC3 mRNA
15979871
hydroxytamoxifen
  • hydroxytamoxifen results in increased expression of ABCC3 mRNA
15072547
Indomethacin
  • Indomethacin inhibits the reaction [ABCC3 protein affects the transport of estradiol-17 beta-glucuronide]
12704183
Indomethacin
  • Indomethacin inhibits the reaction [ABCC3 protein affects the export of 5-carboxyfluorescein diacetate]
16636798
L 742694
  • L 742694 affects the expression of ABCC3 mRNA
  • L 742694 results in increased expression of ABCC3 mRNA
15102944
Lindane
  • Lindane results in increased expression of ABCC3 mRNA
17785943
Lipopolysaccharides
  • Dexamethasone inhibits the reaction [Lipopolysaccharides results in increased expression of ABCC3 mRNA]
  • Lipopolysaccharides results in increased expression of ABCC3 mRNA
15205389
Lipopolysaccharides
  • Lipopolysaccharides results in decreased expression of ABCC3 mRNA
15313196
Lithocholic Acid
  • Lithocholic Acid does not affect the expression of ABCC3 mRNA
12637555
Lithocholic Acid
  • ABCC3 protein affects the export of Lithocholic Acid
  • Lithocholic Acid promotes the reaction [[VDR protein binds to RXRA protein] which results in increased expression of ABCC3]
15824121
Lithocholic Acid
  • NR1I3 protein affects the reaction [Lithocholic Acid results in increased expression of ABCC3 mRNA]
15358766
Lithocholic Acid
  • Lithocholic Acid results in increased expression of ABCC3 mRNA
15824121, 15358766
Mifepristone
  • Mifepristone results in increased expression of ABCC3 mRNA
15456840
monomethylarsonic acid
  • monomethylarsonic acid results in increased expression of ABCC3 mRNA
  • monomethylarsonic acid results in increased expression of ABCC3 protein
16436460
Naloxone
  • Naloxone results in increased expression of ABCC3 mRNA
17522070
nickel sulfate
  • nickel sulfate results in increased expression of ABCC3 mRNA
16314067
Nicotine
  • Nicotine metabolite does not affect the activity of ABCC3 protein
15795089
nicotine N-glucuronide
  • nicotine N-glucuronide does not affect the activity of ABCC3 protein
15795089
Nocodazole
  • Nocodazole results in increased expression of ABCC3 mRNA
10691972
oltipraz
  • [oltipraz results in increased activity of NFE2L2 protein] which results in increased expression of ABCC3 mRNA
  • oltipraz results in increased expression of ABCC3 mRNA
15833929
Oncostatin M
  • Oncostatin M results in increased expression of ABCC3 mRNA
15654950
parthenolide
  • parthenolide inhibits the reaction [Simvastatin results in increased nitrosation of ABCC3 protein]
18463201
Phenobarbital
  • Phenobarbital results in increased expression of ABCC3 mRNA
15986414, 15833929
Phenobarbital
  • Phenobarbital results in increased expression of ABCC3 protein
15908472
Phenobarbital
  • Phenobarbital results in increased expression of ABCC3 protein
15986414
phenobarbital quinidine
  • [phenobarbital quinidine results in increased activity of NR1I3 protein] which results in increased expression of ABCC3 mRNA
15833929
Piperonyl Butoxide
  • [Diethylnitrosamine co-treated with Piperonyl Butoxide] results in increased expression of ABCC3 mRNA
18648771
pirarubicin
  • ABCC3 protein results in chemical resistance to pirarubicin
15884115
pirinixic acid
  • pirinixic acid results in increased expression of ABCC3 mRNA
18301758
Prednisone
  • Prednisone promotes the reaction [ABCC3 protein affects the transport of calcein AM]
  • Prednisone results in increased activity of ABCC3 protein
15979871
Pregnenolone Carbonitrile
  • [Pregnenolone Carbonitrile binds to NR1I2 protein] which results in increased expression of ABCC3 mRNA
15833929
Pregnenolone Carbonitrile
  • Pregnenolone Carbonitrile results in increased expression of ABCC3 mRNA
15986414, 15456840, 15833929
Pregnenolone Carbonitrile
  • Pregnenolone Carbonitrile results in increased expression of ABCC3 protein
15986414
Probenecid
  • Probenecid inhibits the reaction [ABCC3 protein affects the transport of estradiol-17 beta-glucuronide]
12704183
Progesterone
  • [Progesterone co-treated with Estradiol] results in decreased expression of ABCC3 mRNA
17404688
Simvastatin
  • Simvastatin promotes the reaction [Doxorubicin results in increased nitrosation of ABCC3 protein]
  • Simvastatin results in increased nitrosation of ABCC3 protein
  • artemisinine inhibits the reaction [Simvastatin results in increased nitrosation of ABCC3 protein]
  • parthenolide inhibits the reaction [Simvastatin results in increased nitrosation of ABCC3 protein]
18463201
S-nitrosopenicillamine
  • S-nitrosopenicillamine results in increased metabolism of ABCC3 protein
15695394
Spironolactone
  • [Spironolactone binds to NR1I2 protein] which results in increased expression of ABCC3 mRNA
  • Spironolactone results in increased expression of ABCC3 mRNA
15833929
Tamoxifen
  • Tamoxifen affects the expression of ABCC3 mRNA
17555576
Taurochenodeoxycholic Acid
  • Taurochenodeoxycholic Acid results in increased expression of ABCC3 protein
11672435
Taurocholic Acid
  • ABCC3 protein affects the transport of Taurocholic Acid
11557524
Taurocholic Acid
  • Taurocholic Acid results in increased activity of ABCC3 protein
17569508
tauromuricholic acid
  • tauromuricholic acid results in increased expression of ABCC3 protein
11672435
tauroursodeoxycholic acid
  • tauroursodeoxycholic acid results in increased expression of ABCC3 protein
11672435
tauroursodeoxycholic acid
  • tauroursodeoxycholic acid does not affect the expression of ABCC3 mRNA
14623915
Tetrachlorodibenzodioxin
  • [Tetrachlorodibenzodioxin binds to AHR protein] which results in increased expression of ABCC3 mRNA
  • Tetrachlorodibenzodioxin results in increased expression of ABCC3 mRNA
15833929
Tetracycline
  • Tetracycline results in increased expression of ABCC3 mRNA
17522070
Tretinoin
  • Tretinoin results in increased expression of ABCC3 mRNA
16249480
Tretinoin
  • Tretinoin results in decreased expression of ABCC3 mRNA
16604517
trichostatin A
  • trichostatin A results in decreased expression of ABCC3 mRNA
10691972
trimethylarsine oxide
  • trimethylarsine oxide results in increased expression of ABCC3 mRNA
  • trimethylarsine oxide results in increased expression of ABCC3 protein
16436460
Tunicamycin
  • Tunicamycin results in decreased expression of ABCC3 mRNA
17127020
Turpentine
  • Turpentine results in decreased expression of ABCC3 mRNA
15313196
Ursodeoxycholic Acid
  • Ursodeoxycholic Acid results in increased expression of ABCC3 mRNA
12971955
Verapamil
  • Verapamil inhibits the reaction [ABCC3 protein affects the export of 5-carboxyfluorescein diacetate]
16636798

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Cholestasis inferred via Ursodeoxycholic Acid 16487557
Cholestasis, Intrahepatic inferred via Ursodeoxycholic Acid 14728856
Acute-Phase Reaction inferred via Turpentine 16044259
Alopecia inferred via Tretinoin 15955085
Arthritis, Experimental inferred via Tretinoin 16412693
Arthritis, Rheumatoid inferred via Tretinoin 16292516
Asthma inferred via Tretinoin 16456186
Barrett Esophagus inferred via Tretinoin 16935849
Blood Coagulation Disorders inferred via Tretinoin 16197459, 16206674
Breast Neoplasms inferred via Tretinoin 16873071, 16166294, 16443354
Bronchopulmonary Dysplasia inferred via Tretinoin 16813970
Carcinoma, Embryonal inferred via Tretinoin 16168501
Carcinoma, Squamous Cell inferred via Tretinoin 16096774, 16051514
Cataract inferred via Tretinoin 17460283
Cervical Intraepithelial Neoplasia inferred via Tretinoin 16129372
Choriocarcinoma inferred via Tretinoin 16461808
Colitis inferred via Tretinoin 17035595
Craniofacial Abnormalities inferred via Tretinoin 16925845
Endometrial Neoplasms inferred via Tretinoin 16569247
Eye Abnormalities inferred via Tretinoin 16938888
Glioblastoma inferred via Tretinoin 17312396
Head and Neck Neoplasms inferred via Tretinoin 16096774
Hearing Loss, Noise-Induced inferred via Tretinoin 16084493
Hyperalgesia inferred via Tretinoin 16870215
Hypereosinophilic Syndrome inferred via Tretinoin 16778211
Leukemia inferred via Tretinoin 17143497
Leukemia, Myeloid inferred via Tretinoin 16932348, 16482212
Leukemia, Myeloid, Acute inferred via Tretinoin 16294345
Leukemia, Promyelocytic, Acute inferred via Tretinoin 16891316, 16823087, 15748426, 16788101, 16140955, 16331271, 17294898, 17361223, 17368321, 17301526, 17339181, 17506722, 17217047, 16766008, 17107899, 16935935, 12679006
Liver Cirrhosis, Experimental inferred via Tretinoin 16248980, 18397230
Medulloblastoma inferred via Tretinoin 17453147
Melanoma inferred via Tretinoin 16752155
Meningomyelocele inferred via Tretinoin 16940565
Neoplasms inferred via Tretinoin 16946489, 16594593
Ovarian Neoplasms inferred via Tretinoin 16936753
Pain inferred via Tretinoin 16870215
Pancreatic Neoplasms inferred via Tretinoin 15976015
Pterygium inferred via Tretinoin 16723453
Rhabdomyosarcoma inferred via Tretinoin 16116481, 16283617
Skin Neoplasms inferred via Tretinoin 16467112
Stomach Neoplasms inferred via Tretinoin 17261132
Thyroid Neoplasms inferred via Tretinoin 17045167, 16026305
Tongue Neoplasms inferred via Tretinoin 16051514
Tuberculosis inferred via Tretinoin 16040207
Uterine Cervical Neoplasms inferred via Tretinoin 16129372
Uveal Neoplasms inferred via Tretinoin 16752155
Vitiligo inferred via Tretinoin 16761959
Wilms Tumor inferred via Tretinoin 16287080
Fatty Liver inferred via Tetracycline 16917069
Hepatitis, Toxic inferred via Tetracycline 17522070
Nephritis, Interstitial inferred via Tetracycline 9884423
Pemphigoid, Bullous inferred via Tetracycline 11026799
Prion Diseases inferred via Tetracycline 10903871
Adenoma, Liver Cell inferred via Tetrachlorodibenzodioxin 16835633
Carcinoma inferred via Tetrachlorodibenzodioxin 16835633
Cholangiocarcinoma inferred via Tetrachlorodibenzodioxin 16835633
Cleft Palate inferred via Tetrachlorodibenzodioxin 8697196
Diabetes Mellitus, Type 2 inferred via Tetrachlorodibenzodioxin 17107852
Hydronephrosis inferred via Tetrachlorodibenzodioxin 8697196
Liver Neoplasms inferred via Tetrachlorodibenzodioxin 16984957
Breast Neoplasms inferred via Tamoxifen 16202921, 15668708, 17440819, 17893378, 16873071, 16818667, 11161223, 17261762, 17049068, 17242785, 15565566
Carcinoma, Hepatocellular inferred via Tamoxifen 16924424
Carcinoma, Transitional Cell inferred via Tamoxifen 17572228
Endometrial Neoplasms inferred via Tamoxifen 16202921, 17893378
Fatty Liver inferred via Tamoxifen 14986274
Female Urogenital Diseases inferred via Tamoxifen 16709447
Lipidoses inferred via Tamoxifen 15342952
Liver Cirrhosis, Experimental inferred via Tamoxifen 18564211
Liver Neoplasms inferred via Tamoxifen 16684651
Mammary Neoplasms, Experimental inferred via Tamoxifen 11731420, 16827153, 14580682
Melanoma inferred via Tamoxifen 12393984
Melanoma, Amelanotic inferred via Tamoxifen 15990972
Spermatocele inferred via Tamoxifen 16709447
Urinary Bladder Neoplasms inferred via Tamoxifen 16712894, 17572228
Hyperlipoproteinemia Type II inferred via Simvastatin 16238680
Polycystic Ovary Syndrome inferred via Simvastatin 17105841
Brain Hemorrhage, Traumatic inferred via Progesterone 17868700
Brain Injuries inferred via Progesterone 15665606, 15380490, 15845082
Breast Neoplasms inferred via Progesterone 17614352, 16175315, 15562024
Diabetic Neuropathies inferred via Progesterone 17187935
Encephalomyelitis, Autoimmune, Experimental inferred via Progesterone 17692515
Endometriosis inferred via Progesterone 16134523
Mammary Neoplasms, Experimental inferred via Progesterone 17203775, 11408345
Ovarian Neoplasms inferred via Progesterone 17393432, 16525653
Salivary Gland Neoplasms inferred via Progesterone 18045962
Spinal Cord Injuries inferred via Progesterone 15862959, 16503802
Hodgkin Disease inferred via Prednisone 17606976, 16135485, 16794504
Prostatic Neoplasms inferred via Prednisone 16888761
Edema inferred via pirinixic acid 12083418
Liver Neoplasms inferred via pirinixic acid 15890375
Liver Neoplasms inferred via Piperonyl Butoxide 15890375, 18648771
Dystonia inferred via Phenobarbital 1851702
Epilepsy, Absence inferred via Phenobarbital 6401628
Liver Neoplasms inferred via Phenobarbital 15975961, 8742319
Myoclonic Epilepsies, Progressive inferred via Phenobarbital 17484760
Osteomalacia inferred via Phenobarbital 17016548
Pancreatic Neoplasms inferred via Phenobarbital 16965848
Pseudolymphoma inferred via Phenobarbital 12752131
Seizures, Febrile inferred via Phenobarbital 6407741
Breast Neoplasms inferred via parthenolide 16873071
Liver Cirrhosis, Experimental inferred via oltipraz 16544323
Alzheimer Disease inferred via Nicotine 16627626
Neoplasms inferred via Nicotine 16365874
Neovascularization, Pathologic inferred via Nicotine 16365874
Dermatitis, Allergic Contact inferred via nickel sulfate 16780908
Pruritus inferred via Naloxone 15861022
Endometriosis inferred via Mifepristone 16134523
Ovarian Neoplasms inferred via Mifepristone 16525653
Hemolytic-Uremic Syndrome inferred via Lipopolysaccharides 16366002
Inflammation inferred via Lipopolysaccharides 17255318, 17963957
Iron Metabolism Disorders inferred via Lipopolysaccharides 17255318
Respiratory Hypersensitivity inferred via Lipopolysaccharides 10835634
Agricultural Workers' Diseases inferred via Lindane 12661182
Breast Neoplasms inferred via Lindane 14688026
Neoplasms inferred via Lindane 16818664, 12807735
Prostatic Neoplasms inferred via Lindane 14688026, 12661182
Seizures inferred via Lindane 7539098
Adenoma inferred via Indomethacin 11497255
Alzheimer Disease inferred via Indomethacin 15579461
Breast Neoplasms inferred via Indomethacin 17401462
Carcinoma, Hepatocellular inferred via Indomethacin 16391822
Colonic Neoplasms inferred via Indomethacin 11260862, 15786552, 15963497
Colorectal Neoplasms inferred via Indomethacin 18059344, 17054584, 12606626
Duodenal Ulcer inferred via Indomethacin 17045617, 16699067, 17202747
Edema inferred via Indomethacin 8985016
Enteritis inferred via Indomethacin 16328016
Esophageal Neoplasms inferred via Indomethacin 11005569
Glioblastoma inferred via Indomethacin 12870263
Hyperlipidemias inferred via Indomethacin 17546600
Ileal Diseases inferred via Indomethacin 10574470
Intestinal Diseases inferred via Indomethacin 15610444, 15831440, 10210152, 17329856
Jejunal Diseases inferred via Indomethacin 10574470
Leukemia, Myelogenous, Chronic, BCR-ABL Positive inferred via Indomethacin 10785260
Leukemia, Myeloid, Acute inferred via Indomethacin 18360721
Lung Neoplasms inferred via Indomethacin 11497255
Pain inferred via Indomethacin 17440234
Stomach Diseases inferred via Indomethacin 17207306
Stomach Ulcer inferred via Indomethacin 16934674, 15104355, 12077510, 17654042, 12467913, 18299717, 10878458
Ulcer inferred via Indomethacin 10574470
Cleft Palate inferred via Hydrocortisone 15826874
Carcinoma, Squamous Cell inferred via Glutathione 17015178
Dyspnea inferred via Furosemide 16935035
Edema inferred via Furosemide 11834646
Heart Failure inferred via Furosemide 16011733, 12660669, 16845234
Hypercalcemia inferred via Furosemide 17652376
Hypercalciuria inferred via Furosemide 17652376
Hyperparathyroidism, Secondary inferred via Furosemide 15086907
Hypertension, Pregnancy-Induced inferred via Furosemide 16612254
Hypoproteinemia inferred via Furosemide 16096441
Nephrocalcinosis inferred via Furosemide 15086907
Nocturnal Enuresis inferred via Furosemide 17945291
Polyuria inferred via Furosemide 17945291
Reperfusion Injury inferred via Furosemide 16526316
Respiratory Distress Syndrome, Adult inferred via Furosemide 12394941, 15912074, 16096441
Stomach Neoplasms inferred via Furosemide 17052386
Inflammation inferred via Flavonoids 17296493
Bone Marrow Neoplasms inferred via Etoposide 14601052
Breast Neoplasms inferred via Etoposide 16322251
Herpes Simplex inferred via Etoposide 10809021
Hodgkin Disease inferred via Etoposide 17606976, 18180244, 16200630, 16135485, 15147373
Lymphoma inferred via Etoposide 12556972, 12854902
Sarcoma, Ewing's inferred via Etoposide 14601052
Acne Vulgaris inferred via Ethinyl Estradiol 17505938
Adenocarcinoma inferred via Ethinyl Estradiol 14692618
Arteriosclerosis inferred via Ethinyl Estradiol 11256880
Arthritis, Experimental inferred via Ethinyl Estradiol 15885639
Cholestasis inferred via Ethinyl Estradiol 17110522, 16919318, 17681005, 17333356, 11677210, 15861022, 16105132
Encephalomyelitis, Autoimmune, Experimental inferred via Ethinyl Estradiol 12538720
Fatty Liver inferred via Ethinyl Estradiol 15345470
Hypospadias inferred via Ethinyl Estradiol 16569931, 16945680
Infertility, Female inferred via Ethinyl Estradiol 12013081
Infertility, Male inferred via Ethinyl Estradiol 17937319
Panic Disorder inferred via Ethinyl Estradiol 11578682
Pruritus inferred via Ethinyl Estradiol 16919318, 15861022
Spermatocele inferred via Ethinyl Estradiol 16709447
Thrombophilia inferred via Ethinyl Estradiol 11994571
Thrombosis inferred via Ethinyl Estradiol 15669648
Uterine Neoplasms inferred via Ethinyl Estradiol 14692618
Venous Thrombosis inferred via Ethinyl Estradiol 15869587
Burns inferred via Ethanol 16374292
Carcinoma, Hepatocellular inferred via Ethanol 15763234, 15289165
Esophageal Neoplasms inferred via Ethanol 16704527
Fatty Liver inferred via Ethanol 16409862
Fatty Liver, Alcoholic inferred via Ethanol 17920746
Fetal Alcohol Syndrome inferred via Ethanol 16946407
Hepatitis, Toxic inferred via Ethanol 11566570
Liver Cirrhosis inferred via Ethanol 15289165
Liver Cirrhosis, Alcoholic inferred via Ethanol 18295389
Liver Cirrhosis, Experimental inferred via Ethanol 18166357
Liver Diseases, Alcoholic inferred via Ethanol 17207112, 17347304
Breast Neoplasms inferred via Estradiol 17289903, 14630087, 18497071, 17018787, 17261762, 12948864
Candidiasis, Vulvovaginal inferred via Estradiol 16111702
Carcinoma, Hepatocellular inferred via Estradiol 16924424
Herpes Genitalis inferred via Estradiol 15709030
Hot Flashes inferred via Estradiol 17088409
Insulin Resistance inferred via Estradiol 16393666, 16627594
Kidney Diseases inferred via Estradiol 15618244
Kidney Neoplasms inferred via Estradiol 15610895
Liver Cirrhosis, Experimental inferred via Estradiol 14716833, 14659978
Mammary Neoplasms, Experimental inferred via Estradiol 17203775, 11408345, 16891317, 11807958
Myocardial Reperfusion Injury inferred via Estradiol 16810080
Neovascularization, Pathologic inferred via Estradiol 17289903
Prostatic Neoplasms inferred via Estradiol 16740699
Hepatitis, Toxic inferred via Erythromycin Estolate 17522070
Adenocarcinoma inferred via Doxorubicin 17418594
Bone Marrow Neoplasms inferred via Doxorubicin 14601052
Brain Neoplasms inferred via Doxorubicin 17150277
Breast Neoplasms inferred via Doxorubicin 15692762, 16826403, 18382427, 17369602, 16322301, 16096432, 15993339, 15634643, 15567936, 15994142, 15668708, 16264153, 18234424, 15136595, 11325840, 16935488, 18628466, 17983394, 15939500, 17426702
Carcinoid Tumor inferred via Doxorubicin 16051944
Carcinoma, Hepatocellular inferred via Doxorubicin 18059187, 16023760, 16234567, 17876044
Carcinoma, Renal Cell inferred via Doxorubicin 16201981
Cardiomyopathies inferred via Doxorubicin 16952015, 17382496, 16731534, 15505089, 16278810, 15476868, 16269455, 16109756, 16242529, 16364871, 16651473, 17351982, 17131338, 16455267, 18627295, 17329180, 17974986, 17308081, 15811867, 17007740
Cardiomyopathy, Dilated inferred via Doxorubicin 17334414, 16243910
Colorectal Neoplasms inferred via Doxorubicin 18259882
Drug Toxicity inferred via Doxorubicin 18602426
Endometrial Neoplasms inferred via Doxorubicin 17359293
Endomyocardial Fibrosis inferred via Doxorubicin 18037988
Glioblastoma inferred via Doxorubicin 17150277
Head and Neck Neoplasms inferred via Doxorubicin 15692506
Heart Diseases inferred via Doxorubicin 16707910, 16879835, 16144979, 16244372, 16244371, 16330681
Hemangiosarcoma inferred via Doxorubicin 15692506
Hepatitis, Toxic inferred via Doxorubicin 17416283
Hodgkin Disease inferred via Doxorubicin 17606976, 15147373, 18501091
Kidney Diseases inferred via Doxorubicin 16775033, 15369732
Kidney Failure inferred via Doxorubicin 17922066
Kidney Failure, Chronic inferred via Doxorubicin 16707910
Leukemia, Erythroblastic, Acute inferred via Doxorubicin 16085563
Liver Cirrhosis, Experimental inferred via Doxorubicin 16595196, 16439617
Liver Neoplasms, Experimental inferred via Doxorubicin 17085340, 16842330
Lung Neoplasms inferred via Doxorubicin 17418594
Lymphoma inferred via Doxorubicin 16098063
Lymphoma, Non-Hodgkin inferred via Doxorubicin 17654614
Lymphoma, T-Cell inferred via Doxorubicin 15621674
Mammary Neoplasms, Experimental inferred via Doxorubicin 15458769
Melanoma inferred via Doxorubicin 16827129
Mucositis inferred via Doxorubicin 17415656
Neoplasm Metastasis inferred via Doxorubicin 18259882
Nephrotic Syndrome inferred via Doxorubicin 15640375, 16889571
Neuroblastoma inferred via Doxorubicin 15555623
Osteosarcoma inferred via Doxorubicin 15930896
Phyllodes Tumor inferred via Doxorubicin 17983394
Prostatic Neoplasms inferred via Doxorubicin 15897917, 15749863, 16729912, 16868541, 16888761, 18437689
Sarcoma inferred via Doxorubicin 18313854, 17710206, 17203757, 15625365, 15675481, 16767912
Sarcoma, Ewing's inferred via Doxorubicin 14601052, 16326096
Sarcoma, Kaposi inferred via Doxorubicin 17846226
Skin Neoplasms inferred via Doxorubicin 15692506
Soft Tissue Neoplasms inferred via Doxorubicin 16767912, 17203757, 15625365
Thyroid Neoplasms inferred via Doxorubicin 17909728, 16010429
Urinary Bladder Neoplasms inferred via Doxorubicin 17653716
Ventricular Dysfunction, Left inferred via Doxorubicin 17334414, 16364871
Cholestasis inferred via Diosgenin 16105132
Adenocarcinoma inferred via Dimethylnitrosamine 16033868
Carcinoma, Squamous Cell inferred via Dimethylnitrosamine 16033868
Esophageal Neoplasms inferred via Dimethylnitrosamine 17016578
Liver Cirrhosis, Experimental inferred via Dimethylnitrosamine 17203207, 17036385, 18210741, 17534399, 17465448, 16570917, 14568256, 15571005, 15161499, 12918455, 15298665, 16042886, 15479170, 17196135, 15383259, 14659978, 17348192, 17201889, 18237412, 17719030, 15081153, 16169303, 14643895, 18567088, 15798949, 16627068, 15942678, 15744066, 15591649, 18239293, 16270385, 17881167, 15492853, 18629640, 16009107, 18637143, 18672772, 15067225, 17640959, 18364076, 15369754, 15099470, 14709902, 15339415, 17432682, 17198567, 15086199, 15733078, 15577212, 15504291, 17666798, 15138612, 16603200, 17724770, 15723089, 14726149, 15864749, 15763062, 16544323, 15842777, 15793283, 18371158, 12925901, 15366600, 18095165
Liver Failure, Acute inferred via Dimethylnitrosamine 17457977
Liver Neoplasms inferred via Dimethylnitrosamine 3113478, 15890375
Liver Neoplasms, Experimental inferred via Dimethylnitrosamine 15603536
Lung Neoplasms inferred via Dimethylnitrosamine 16061637
Stomach Neoplasms inferred via Dimethylnitrosamine 16033868
Adenoma inferred via Diethylnitrosamine 10737359
Carcinoma, Hepatocellular inferred via Diethylnitrosamine 16878318, 11831363, 17428255, 10672840, 10737359
Liver Neoplasms inferred via Diethylnitrosamine 2422723, 18648771, 10737359, 16942905, 12112319, 15885732
Liver Neoplasms, Experimental inferred via Diethylnitrosamine 16267830, 3124819, 16842330
Dermatitis, Atopic inferred via Diethylhexyl Phthalate 16882537
Colonic Neoplasms inferred via Dexamethasone 15824018
Liver Cirrhosis, Experimental inferred via Dexamethasone 16718785
Lung Neoplasms inferred via Dexamethasone 15824018, 11195469
Multiple Myeloma inferred via Dexamethasone 15867202, 16118317, 15744524
Respiratory Distress Syndrome, Adult inferred via Dexamethasone 11700416
Colonic Neoplasms inferred via Deoxycholic Acid 16213893
Gingival Hyperplasia inferred via Cyclosporine 8708960
Metal Metabolism, Inborn Errors inferred via Cyclosporine 16801185
Nephrosis, Lipoid inferred via Cyclosporine 17954296
Nephrotic Syndrome inferred via Cyclosporine 18481113
Psoriasis inferred via Cyclosporine 16882103
Liver Neoplasms inferred via Clofibric Acid 17602206
Dyslipidemias inferred via Clofibrate 16707586
Niemann-Pick Disease, Type C inferred via Clofibrate 9802331
Hepatitis, Toxic inferred via Chloroform 3104120, 17522070
Carbon Tetrachloride Poisoning inferred via Carbon Tetrachloride 16192424, 16050911, 15673190, 16011737, 15700767, 16124888, 16227642, 10355542, 16097048
Fatty Liver inferred via Carbon Tetrachloride 16045604, 15959796, 17595544, 12631006, 61145, 12795759, 16239168
Hepatitis, Toxic inferred via Carbon Tetrachloride 17522070, 11566570, 15998439, 15027814, 15968718, 16227642, 16177239
Hyperbilirubinemia inferred via Carbon Tetrachloride 16899240
Liver Cirrhosis inferred via Carbon Tetrachloride 17174718, 16943688, 16221502, 16239168, 17334410
Liver Cirrhosis, Experimental inferred via Carbon Tetrachloride 16192424, 15925388, 16116963, 15730626, 12632514, 15052691, 12632512, 17766677, 18418968, 12666154, 16638106, 18395095, 15996030, 16033810, 17565644, 17869086, 17708605, 12667390, 14748882, 13678700, 15818738, 17631135, 16097048, 15673190, 12649538, 17721639, 18277467, 18205269, 14716496, 15123356, 18339082, 18429990, 12546737, 18006644, 18481824, 15057751, 12586293, 18054572, 18166357, 17922224, 18420326, 15876570, 12445421, 12445418, 15959796, 12898905, 18317297, 17761835, 14620537, 18472332, 14716833, 16136751, 17481882, 17900296, 12389079, 18187930, 18210741, 16015684, 12741479, 14724832, 18472094, 15931870, 17698563, 15893842, 12958196, 17640975, 18412020, 17714472, 14512876, 12609069, 10355542, 16011737, 18251166, 17823541, 17944888, 18395914, 18279442, 16027843, 18376398, 18156304, 17976157, 17557913, 17805973, 17525996, 16248980
Liver Diseases inferred via Carbon Tetrachloride 16246199, 17285989, 15830285, 15720792, 16964402
Liver Failure inferred via Carbon Tetrachloride 15123358
Liver Failure, Acute inferred via Carbon Tetrachloride 14706259, 16899240
Liver Neoplasms, Experimental inferred via Carbon Tetrachloride 15583823
Breast Neoplasms inferred via Calcitriol 11237771
Carcinoma, Squamous Cell inferred via Calcitriol 11237771
Encephalomyelitis, Autoimmune, Experimental inferred via Calcitriol 15138306
Prostatic Hyperplasia inferred via Calcitriol 15572423
Prostatic Neoplasms inferred via Calcitriol 12479363, 16289102, 16644109
Urinary Bladder Neoplasms inferred via Cacodylic Acid 15537745
Coronary Artery Disease inferred via atorvastatin 16368305
Heart Failure inferred via atorvastatin 16360360
Hyperlipoproteinemia Type II inferred via atorvastatin 16238680
Liver Cirrhosis, Experimental inferred via atorvastatin 17347453
Pancreatitis inferred via artemisinine 17948936
Breast Neoplasms inferred via allyl sulfide 17125941
Hepatitis, Toxic inferred via allyl sulfide 15950962
Hepatitis, Viral, Human inferred via allyl sulfide 15950962
Breast Neoplasms inferred via alitretinoin 16344269
Keratosis, Seborrheic inferred via alitretinoin 16144296
Lung Neoplasms inferred via alitretinoin 16413115
Neoplasms inferred via alitretinoin 16946489
Porokeratosis inferred via alitretinoin 16144296
Hepatitis, Toxic inferred via Acetaminophen 2444490, 16081117, 17522070, 17562736, 14986274, 15968718, 16227642, 16177239
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215
Adenoma, Liver Cell inferred via 3,4,5,3',4'-pentachlorobiphenyl 16628245
Cholangiocarcinoma inferred via 3,4,5,3',4'-pentachlorobiphenyl 16628245
Adenoma inferred via 2-Acetylaminofluorene 10737359
Carcinoma, Hepatocellular inferred via 2-Acetylaminofluorene 10737359
Liver Neoplasms inferred via 2-Acetylaminofluorene 10737359, 10672840, 11376686, 16273603, 18001218, 14678523
Lung Neoplasms inferred via 2-Acetylaminofluorene 11376686
Urinary Bladder Neoplasms inferred via 2-Acetylaminofluorene 15867355, 15289314
Cholestasis, Intrahepatic inferred via 1-Naphthylisothiocyanate 10220858
Hepatitis, Toxic inferred via 1-Naphthylisothiocyanate 17522070
Liver Diseases inferred via 1-Naphthylisothiocyanate 17184895
Encephalomyelitis, Autoimmune, Experimental inferred via 15-deoxy-delta(12,14)-prostaglandin J2 16844232

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Zehnpfennig B, et al. (2009) "Functional reconstitution of human ABCC3 into proteoliposomes reveals a transport mechanism with positive cooperativity." Biochemistry. 48(20):4423-4430. PMID:19334674
  2. [ + ] van de Wetering K, et al. (2009) "Intestinal breast cancer resistance protein (BCRP)/Bcrp1 and multidrug resistance protein 3 (MRP3)/Mrp3 are involved in the pharmacokinetics of resveratrol." Mol Pharmacol. 75(4):876-885. PMID:19114588
  3. [ + ] Muller PJ, et al. (2009) "Polymorphisms in ABCG2, ABCC3 and CNT1 genes and their possible impact on chemotherapy outcome of lung cancer patients." Int J Cancer. 124(7):1669-1674. PMID:19107936
  4. [ + ] Saito A, et al. (2009) "Association study between single-nucleotide polymorphisms in 199 drug-related genes and commonly measured quantitative traits of 752 healthy Japanese subjects." J Hum Genet. 54(6):317-323. PMID:19343046
  5. [ + ] O'Brien C, et al. (2008) "Functional genomics identifies ABCC3 as a mediator of taxane resistance in HER2-amplified breast cancer." Cancer Res. 68(13):5380-5389. PMID:18593940
  6. [ + ] Muller P, et al. (2008) "Polymorphisms in transporter and phase II metabolism genes as potential modifiers of the predisposition to and treatment outcome of de novo acute myeloid leukemia in Israeli ethnic groups." Leuk Res. 32(6):919-929. PMID:18207572
  7. [ + ] Campa D, et al. (2008) "Could polymorphisms in ATP-binding cassette C3/multidrug resistance associated protein 3 (ABCC3/MRP3) modify colorectal cancer risk?" Eur J Cancer. 44(6):854-857. PMID:18313914
  8. [ + ] Lu MC, et al. (2008) "Increased multidrug resistance-associated protein activity in mononuclear cells of patients with systemic lupus erythematosus." Clin Exp Rheumatol. 26(4):638-645. PMID:18799096
  9. [ + ] Kobayashi K, et al. (2008) "Functional analysis of nonsynonymous single nucleotide polymorphism type ATP-binding cassette transmembrane transporter subfamily C member 3." Pharmacogenet Genomics. 18(9):823-833. PMID:18698235
  10. [ + ] Hanada S, et al. (2008) "Expression profile of early lung adenocarcinoma: identification of MRP3 as a molecular marker for early progression." J Pathol. 216(1):75-82. PMID:18604784
  11. [ + ] Gradhand U, et al. (2007) "Functional analysis of the polymorphism -211C>T in the regulatory region of the human ABCC3 gene." Life Sci. 80(16):1490-1494. PMID:17300812
  12. [ + ] Adachi T, et al. (2007) "Nrf2-dependent and -independent induction of ABC transporters ABCC1, ABCC2, and ABCG2 in HepG2 cells under oxidative stress." J Exp Ther Oncol. 6(4):335-348. PMID:18038766
  13. [ + ] Fukushima-Uesaka H, et al. (2007) "Genetic variations of the ABC transporter gene ABCC3 in a Japanese population." Drug Metab Pharmacokinet. 22(2):129-135. PMID:17495421
  14. [ + ] Letourneau IJ, et al. (2007) "Mutational analysis of a highly conserved proline residue in MRP1, MRP2, and MRP3 reveals a partially conserved function." Drug Metab Dispos. 35(8):1372-1379. PMID:17494643
  15. [ + ] van de Wetering K, et al. (2007) "Multidrug resistance proteins 2 and 3 provide alternative routes for hepatic excretion of morphine-glucuronides." Mol Pharmacol. 72(2):387-394. PMID:17485564
  16. [ + ] Chen W, et al. (2007) "Nuclear receptors RXRalpha:RARalpha are repressors for human MRP3 expression." Am J Physiol Gastrointest Liver Physiol. 292(5):G1221-G1227. PMID:17272513
  17. [ + ] Gedeon C, et al. (2006) "Transport of glyburide by placental ABC transporters: implications in fetal drug exposure." Placenta. 27(11-12):1096-1102. PMID:16460798
  18. [ + ] Nishimura M, et al. (2006) "Regulation of mRNA expression of MDR1, MRP1, MRP2 and MRP3 by prototypical microsomal enzyme inducers in primary cultures of human and rat hepatocytes." Drug Metab Pharmacokinet. 21(4):297-307. PMID:16946557
  19. [ + ] Doerfel C, et al. (2006) "In acute leukemia, the polymorphism -211C>T in the promoter region of the multidrug resistance-associated protein 3 (MRP3) does not determine the expression level of the gene." Pharmacogenet Genomics. 16(2):149-150. PMID:16424827
  20. [ + ] McCarthy TC, et al. (2005) "Vitamin D receptor-dependent regulation of colon multidrug resistance-associated protein 3 gene expression by bile acids." J Biol Chem. 280(24):23232-23242. PMID:15824121
  21. [ + ] Konig J, et al. (2005) "Expression and localization of human multidrug resistance protein (ABCC) family members in pancreatic carcinoma." Int J Cancer. 115(3):359-367. PMID:15688370
  22. [ + ] Benderra Z, et al. (2005) "MRP3, BCRP, and P-glycoprotein activities are prognostic factors in adult acute myeloid leukemia." Clin Cancer Res. 11(21):7764-7772. PMID:16278398
  23. [ + ] Lang T, et al. (2004) "Genetic polymorphisms in the multidrug resistance-associated protein 3 (ABCC3, MRP3) gene and relationship to its mRNA and protein expression in human liver." Pharmacogenetics. 14(3):155-164. PMID:15167703
  24. [ + ] Hillman RT, et al. (2004) "An unappreciated role for RNA surveillance." Genome Biol. 5(2):R8. PMID:14759258
  25. [ + ] Zelcer N, et al. (2003) "Transport of bile acids in multidrug-resistance-protein 3-overexpressing cells co-transfected with the ileal Na+-dependent bile-acid transporter." Biochem J. 369(Pt 1):23-30. PMID:12220224
  26. [ + ] Bodo A, et al. (2003) "Differential modulation of the human liver conjugate transporters MRP2 and MRP3 by bile acids and organic anions." J Biol Chem. 278(26):23529-23537. PMID:12704183
  27. [ + ] Hooijberg JH, et al. (2003) "The role of multidrug resistance proteins MRP1, MRP2 and MRP3 in cellular folate homeostasis." Biochem Pharmacol. 65(5):765-771. PMID:12628490
  28. [ + ] Scheffer GL, et al. (2002) "Tissue distribution and induction of human multidrug resistant protein 3." Lab Invest. 82(2):193-201. PMID:11850532
  29. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  30. [ + ] Tatebe S, et al. (2002) "Induction of multidrug resistance proteins MRP1 and MRP3 and gamma-glutamylcysteine synthetase gene expression by nonsteroidal anti-inflammatory drugs in human colon cancer cells." Biochem Biophys Res Commun. 290(5):1427-1433. PMID:11820781
  31. [ + ] Nies AT, et al. (2001) "Expression of the multidrug resistance proteins MRP2 and MRP3 in human hepatocellular carcinoma." Int J Cancer. 94(4):492-499. PMID:11745434
  32. [ + ] Takada T, et al. (2000) "Characterization of 5'-flanking region of human MRP3." Biochem Biophys Res Commun. 270(3):728-732. PMID:10772892
  33. [ + ] Konig J, et al. (1999) "Characterization of the human multidrug resistance protein isoform MRP3 localized to the basolateral hepatocyte membrane." Hepatology. 29(4):1156-1163. PMID:10094960
  34. [ + ] Ortiz DF, et al. (1999) "MRP3, a new ATP-binding cassette protein localized to the canalicular domain of the hepatocyte." Am J Physiol. 276(6 Pt 1):G1493-G1500. PMID:10362653
  35. [ + ] Kool M, et al. (1999) "MRP3, an organic anion transporter able to transport anti-cancer drugs." Proc Natl Acad Sci U S A. 96(12):6914-6919. PMID:10359813
  36. [ + ] Cole SP, et al. (1999) "Re: Characterization of MOAT-C and MOAT-D, new members of the MRP/cMOAT subfamily of transporter proteins." J Natl Cancer Inst. 91(10):888-889. PMID:10340910
  37. [ + ] Fromm MF, et al. (1999) "Human MRP3 transporter: identification of the 5'-flanking region, genomic organization and alternative splice variants." Biochim Biophys Acta. 1415(2):369-374. PMID:9889399
  38. [ + ] Uchiumi T, et al. (1998) "Isolation of a novel human canalicular multispecific organic anion transporter, cMOAT2/MRP3, and its expression in cisplatin-resistant cancer cells with decreased ATP-dependent drug transport." Biochem Biophys Res Commun. 252(1):103-110. PMID:9813153
  39. [ + ] Belinsky MG, et al. (1998) "Characterization of MOAT-C and MOAT-D, new members of the MRP/cMOAT subfamily of transporter proteins." J Natl Cancer Inst. 90(22):1735-1741. PMID:9827529
  40. [ + ] Kiuchi Y, et al. (1998) "cDNA cloning and inducible expression of human multidrug resistance associated protein 3 (MRP3)." FEBS Lett. 433(1-2):149-152. PMID:9738950
  41. [ + ] Kool M, et al. (1997) "Analysis of expression of cMOAT (MRP2), MRP3, MRP4, and MRP5, homologues of the multidrug resistance-associated protein gene (MRP1), in human cancer cell lines." Cancer Res. 57(16):3537-3547. PMID:9270026
  42. [ + ] Allikmets R, et al. (1996) "Characterization of the human ABC superfamily: isolation and mapping of 21 new genes using the expressed sequence tags database." Hum Mol Genet. 5(10):1649-1655. PMID:8894702