ABCB11 | GeneID:8647 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 8647 Official Symbol ABCB11
Locus N/A Gene Type protein-coding
Synonyms ABC16; BRIC2; BSEP; PFIC-2; PFIC2; PGY4; SPGP
Full Name ATP-binding cassette, sub-family B (MDR/TAP), member 11
Description ATP-binding cassette, sub-family B (MDR/TAP), member 11
Chromosome 2q24
Also Known As ABC member 16, MDR/TAP subfamily; bile salt export pump; progressive familial intrahepatic cholestasis 2; sister p-glycoprotein
Summary The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. The protein encoded by this gene is the major canalicular bile salt export pump in man. Mutations in this gene cause a form of progressive familial intrahepatic cholestases which are a group of inherited disorders with severe cholestatic liver disease from early infancy. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 74509

ID Symbol Protein Species
GeneID:8647 ABCB11 NP_003733.2 Homo sapiens
GeneID:27413 Abcb11 NP_066302.2 Mus musculus
GeneID:470717 ABCB11 XP_526100.2 Pan troglodytes
GeneID:488390 ABCB11 XP_545512.2 Canis lupus familiaris
GeneID:531150 ABCB11 XP_609636.3 Bos taurus
GeneID:570936 LOC570936 XP_699562.3 Danio rerio
GeneID:571189 LOC571189 XP_001923538.1 Danio rerio
GeneID:4324720 Os01g0723800 NP_001044110.1 Oryza sativa

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab71793 ABCB11 antibody - Carboxyterminal end (ab71793); Rabbit polyclonal to ABCB11 - Carboxyterminal end
2 abgent AP6110a ABCB11 Antibody (C-term); Purified Rabbit Polyclonal Antibody (Pab)
3 acris AP13073PU-N ABCB11 (C-term); antibody Ab
4 scbt ABCB11 ABCB11 Antibody / ABCB11 Antibodies;
5 sigma HPA019035 Anti-ABCB11 antibody produced in rabbit ;

Exon, Intron and UTRs

Exon, Intron and UTRs of ABCB11 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ABCB11 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0045177 Component apical part of cell
GO:0005887 Component integral to plasma membrane
GO:0046581 Component intercellular canaliculus
GO:0016020 Component membrane
GO:0005624 Component membrane fraction
GO:0016887 Function ATPase activity
GO:0005524 Function ATP binding
GO:0015432 Function bile acid-exporting ATPase activity
GO:0000166 Function nucleotide binding
GO:0008554 Function sodium-exporting ATPase activity, phosphorylative mechanism
GO:0005215 Function transporter activity
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_003742  UCSC Browser NP_003733

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000263817 MI0000809 hsa-miR-151-5p UCGAGGAGCUCACAGUCUAGU
ENST00000263817 MI0000681 hsa-miR-155* CUCCUACAUAUUAGCAUUAACA
ENST00000263817 MI0000115 hsa-miR-16-2* CCAAUAUUACUGUGCUGCUUUA
ENST00000263817 MI0000271 hsa-miR-181c AACAUUCAACCUGUCGGUGAGU
ENST00000263817 MI0001150 hsa-miR-196b UAGGUAGUUUCCUGUUGUUGGG
ENST00000263817 MI0000239 hsa-miR-197 UUCACCACCUUCUCCACCCAGC
ENST00000263817 MI0000284 hsa-miR-204 UUCCCUUUGUCAUCCUAUGCCU
ENST00000263817 MI0000287 hsa-miR-211 UUCCCUUUGUCAUCCUUCGCCU
ENST00000263817 MI0000078 hsa-miR-22 AAGCUGCCAGUUGAAGAACUGU
ENST00000263817 MI0000105 hsa-miR-29b-1* GCUGGUUUCAUAUGGUGGUUUAGA
ENST00000263817 MI0000107 hsa-miR-29b-2* CUGGUUUCACAUGGUGGCUUAG
ENST00000263817 MI0000749 hsa-miR-30e UGUAAACAUCCUUGACUGGAAG
ENST00000263817 MI0000762 hsa-miR-362-5p AAUCCUUGGAACCUAGGUGUGAGU
ENST00000263817 MI0000778 hsa-miR-370 GCCUGCUGGGGUGGAACCUGGU
ENST00000263817 MI0003685 hsa-miR-421 AUCAACAGACAUUAAUUGGGCGC
ENST00000263817 MI0002470 hsa-miR-486-5p UCCUGUACUGAGCUGCCCCGAG
ENST00000263817 MI0003184 hsa-miR-500 UAAUCCUUGCUACCUGGGUGAGA
ENST00000263817 MI0003196 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENST00000263817 MI0005530 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENST00000263817 MI0005717 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENST00000263817 MI0003170 hsa-miR-518a-5p CUGCAAAGGGAAGCCCUUUC
ENST00000263817 MI0003173 hsa-miR-518a-5p CUGCAAAGGGAAGCCCUUUC
ENST00000263817 MI0003596 hsa-miR-548b-3p CAAGAACCUCAGUUGCUUUUGU
ENST00000263817 MI0003600 hsa-miR-550* UGUCUUACUCCCUCAGGCACAU
ENST00000263817 MI0003601 hsa-miR-550* UGUCUUACUCCCUCAGGCACAU
ENST00000263817 MI0003589 hsa-miR-582-3p UAACUGGUUGAACAACUGAACC
ENST00000263817 MI0003609 hsa-miR-597 UGUGUCACUCGAUGACCACUGU
ENST00000263817 MI0003618 hsa-miR-605 UAAAUCCCAUGGUGCCUUCUCCU
ENST00000263817 MI0005538 hsa-miR-892b CACUGGCUCCUUUCUGGGUAGA
ENST00000263817 MI0005493 mmu-miR-327 ACUUGAGGGGCAUGAGGAU
ENST00000263817 MI0005505 mmu-miR-466c-5p GAUGUGUGUGUGCAUGUACAUA
ENST00000263817 MI0004696 mmu-miR-712 CUCCUUCACCCGGGCGGUACC
ENST00000263817 MI0004678 mmu-miR-720 AUCUCGCUGGGGCCUCCA
ENST00000263817 MI0000613 rno-miR-336 UCACCCUUCCAUAUCUAGUCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
1,2-bis(2-aminophenoxy)ethane N,N,N',N'-tetraacetic acid acetoxymethyl ester
  • 1,2-bis(2-aminophenoxy)ethane N,N,N',N'-tetraacetic acid acetoxymethyl ester affects the localization of and affects the activity of ABCB11 protein
15763547
1-(4-(4-(3,3-dibutyl-7-(dimethylamino)-2,3,4,5-tetrahydro-4-hydroxy-1,1-dioxido-1-benzothiepin-5-yl)phenoxy)butyl)-4-aza-1-azoniabicyclo(2.2.2)octane
  • 1-(4-(4-(3,3-dibutyl-7-(dimethylamino)-2,3,4,5-tetrahydro-4-hydroxy-1,1-dioxido-1-benzothiepin-5-yl)phenoxy)butyl)-4-aza-1-azoniabicyclo(2.2.2)octane results in decreased expression of ABCB11 mRNA
15254889
1-(5-Isoquinolinesulfonyl)-2-Methylpiperazine
  • 1-(5-Isoquinolinesulfonyl)-2-Methylpiperazine inhibits the reaction [tert-Butylhydroperoxide affects the localization of ABCB11 protein]
16452108
17alpha-ethynylestr-5(10)-ene-3alpha,17beta-diol
  • 17alpha-ethynylestr-5(10)-ene-3alpha,17beta-diol results in increased expression of ABCB11 mRNA
17275934
1-Naphthylisothiocyanate
  • 1-Naphthylisothiocyanate does not affect the expression of ABCB11 protein
15955216
1-Naphthylisothiocyanate
  • 1-Naphthylisothiocyanate does not affect the expression of ABCB11 mRNA
14623915
1-Naphthylisothiocyanate
  • 1-Naphthylisothiocyanate results in decreased expression of ABCB11 mRNA
17522070
4,4-difluoro-4-bora-3a,4a-diaza-s-indacene
  • ABCB11 protein affects the transport of 4,4-difluoro-4-bora-3a,4a-diaza-s-indacene
12739759
6-ethylchenodeoxycholic acid
  • 6-ethylchenodeoxycholic acid promotes the reaction [PRMT1 protein binds to ABCB11 promoter]
  • 6-ethylchenodeoxycholic acid results in increased expression of ABCB11 mRNA
15911693
6-ethylchenodeoxycholic acid
  • 6-ethylchenodeoxycholic acid results in increased expression of ABCB11 mRNA
15644430
Acetaminophen
  • Acetaminophen results in decreased expression of ABCB11 mRNA
17522070
Acetaminophen
  • Acetaminophen affects the expression of ABCB11 mRNA
17562736
Agkistrodon venoms
  • Agkistrodon venoms results in increased expression of ABCB11 mRNA
15844712
alpha-Linolenic Acid
  • alpha-Linolenic Acid promotes the reaction [GW 4064 results in increased expression of ABCB11 mRNA]
15307955
Arachidonic Acid
  • Arachidonic Acid promotes the reaction [GW 4064 results in increased expression of ABCB11 mRNA]
15307955
atorvastatin
  • atorvastatin inhibits the reaction [ABCB11 protein affects the import of Taurocholic Acid]
  • atorvastatin inhibits the reaction [ABCB11 protein affects the import of Taurocholic Acid]
15901796
bexarotene
  • bexarotene results in increased expression of ABCB11 mRNA
16648578
Bezafibrate
  • Bezafibrate results in decreased expression of ABCB11 mRNA
15447978
Bile Acids and Salts
  • ABCB11 protein affects the export of Bile Acids and Salts
15696852
Bile Acids and Salts
  • Bile Acids and Salts results in increased expression of ABCB11 mRNA
  • pregna-4,17-diene-3,16-dione inhibits the reaction [Bile Acids and Salts results in increased expression of ABCB11 mRNA]
12705905
Bile Acids and Salts
  • Bile Acids and Salts results in increased expression of ABCB11 mRNA
12135489
Bile Acids and Salts
  • ABCB11 protein affects the transport of Bile Acids and Salts
15901796
Bile Acids and Salts
  • ABCB11 protein affects the export of Bile Acids and Salts
15826951
Bile Acids and Salts
  • Bile Acids and Salts promotes the reaction [PRKCA protein results in increased phosphorylation of ABCB11 protein]
  • Bile Acids and Salts results in increased activity of ABCB11 protein
11343252
Bile Acids and Salts
  • Bile Acids and Salts analog results in increased expression of ABCB11 mRNA
15145977
Bile Acids and Salts
  • ABCB11 protein affects the transport of Bile Acids and Salts
15582136, 12663868
Bile Acids and Salts
  • ABCB11 protein results in increased secretion of Bile Acids and Salts
14570929
Bile Acids and Salts
  • ABCB11 protein affects the secretion of Bile Acids and Salts
15841457
blebbistatin
  • blebbistatin results in decreased localization of ABCB11 protein
15826951
bosentan
  • bosentan metabolite results in decreased activity of ABCB11 protein
11309550
bosentan
  • bosentan results in decreased activity of ABCB11 protein
15509663, 15465654, 11309550
Bucladesine
  • Bucladesine inhibits the reaction [tert-Butylhydroperoxide affects the localization of ABCB11 protein]
16452108
calcein AM
  • ABCB11 protein affects the export of calcein AM
  • Cyclosporine does not affect the reaction [ABCB11 protein affects the export of calcein AM]
  • Reserpine does not affect the reaction [ABCB11 protein affects the export of calcein AM]
  • ditekiren inhibits the reaction [ABCB11 protein affects the export of calcein AM]
10617675
Carbon Tetrachloride
  • Carbon Tetrachloride does not affect the expression of ABCB11 protein
12642476
Carbon Tetrachloride
  • Carbon Tetrachloride results in decreased expression of ABCB11 mRNA
17522070
cerivastatin
  • ABCB11 protein does not affect the import of cerivastatin
  • cerivastatin inhibits the reaction [ABCB11 protein affects the import of Taurocholic Acid]
  • ABCB11 protein does not affect the import of cerivastatin
  • cerivastatin inhibits the reaction [ABCB11 protein affects the import of Taurocholic Acid]
15901796
Chenodeoxycholic Acid
  • Chenodeoxycholic Acid results in increased expression of ABCB11 mRNA
14684751, 12525500, 12519787
Chenodeoxycholic Acid
  • ABCB11 protein affects the transport of Chenodeoxycholic Acid
15297262
Chenodeoxycholic Acid
  • LG 100268 inhibits the reaction [Chenodeoxycholic Acid results in increased expression of ABCB11 mRNA]
12519787
Chenodeoxycholic Acid
  • [pregna-4,17-diene-3,16-dione co-treated with Chenodeoxycholic Acid] results in increased expression of ABCB11 mRNA
12525500
Chloroform
  • Chloroform results in decreased expression of ABCB11 mRNA
17522070
Cholates
  • ABCB11 protein affects the transport of Cholates
15297262
Cholates
  • Cholates results in increased expression of ABCB11 mRNA
14684751
Cholestanols
  • Cholestanols analog results in increased expression of ABCB11 mRNA
15145977
Cholesterol
  • ABCB11 protein results in increased secretion of Cholesterol
14570929
Cholesterol, Dietary
  • Cholesterol, Dietary does not affect the expression of ABCB11 mRNA
  • [Cholesterol, Dietary co-treated with Cholic Acid] results in increased expression of ABCB11 mRNA
14684380
Cholic Acid
  • Cholic Acid results in increased expression of ABCB11 mRNA
  • [Cholesterol, Dietary co-treated with Cholic Acid] results in increased expression of ABCB11 mRNA
14684380
Cholic Acid
  • Cholic Acid results in increased expression of ABCB11 mRNA
15694933, 12971955, 11438506, 15466244
Cholic Acid
  • Cholic Acid results in increased expression of ABCB11 protein
15466244, 11438506
cholyl-lysylfluorescein
  • ABCB11 protein affects the secretion of cholyl-lysylfluorescein
12865277
ciprofibrate
  • ciprofibrate results in decreased expression of ABCB11 protein
12381268
Clofibric Acid
  • [Diethylnitrosamine co-treated with Clofibric Acid] affects the expression of ABCB11 mRNA
17602206
Cloxacillin
  • Cloxacillin results in decreased activity of ABCB11 protein
  • Cloxacillin results in decreased activity of ABCB11 protein
15618715
Colchicine
  • Colchicine affects the localization of ABCB11 protein
15304119, 12702492
coumarin
  • coumarin affects the expression of ABCB11 mRNA
16963487
Cyclosporine
  • Cyclosporine affects the localization of ABCB11 protein
12563113
Cyclosporine
  • Cyclosporine results in decreased activity of ABCB11 protein
15618715
Cyclosporine
  • Cyclosporine results in decreased activity of ABCB11 protein
15618715, 12739759
Cyclosporine
  • Cyclosporine results in decreased activity of ABCB11 protein
11343252
Cyclosporine
  • Cyclosporine does not affect the reaction [ABCB11 protein affects the export of calcein AM]
10617675
Daunorubicin
  • ABCB11 protein does not affect the uptake of Daunorubicin
10617675
Deoxycholic Acid
  • Deoxycholic Acid results in increased expression of ABCB11 mRNA
14684751
Dexamethasone
  • Dexamethasone does not affect the expression of ABCB11 protein
15258109
Dexamethasone
  • Dexamethasone does not affect the expression of ABCB11 mRNA
12135489
Diethylnitrosamine
  • [Diethylnitrosamine co-treated with Clofibric Acid] affects the expression of ABCB11 mRNA
17602206
Digoxin
  • ABCB11 protein does not affect the uptake of Digoxin
10617675
dihydrofluorescein
  • ABCB11 protein affects the transport of dihydrofluorescein
12739759
Diosgenin
  • Diosgenin does not affect the expression of ABCB11 mRNA
15611112
ditekiren
  • ditekiren inhibits the reaction [ABCB11 protein affects the export of calcein AM]
10617675
Docosahexaenoic Acids
  • Docosahexaenoic Acids promotes the reaction [GW 4064 results in increased expression of ABCB11 mRNA]
15307955
Endotoxins
  • Endotoxins inhibits the reaction [Pregnenolone Carbonitrile results in increased expression of ABCB11 mRNA]
15456840
Erythromycin Estolate
  • Erythromycin Estolate results in decreased expression of ABCB11 mRNA
17522070
Estradiol
  • Estradiol results in decreased expression of ABCB11 mRNA
12135489
estradiol-17 beta-glucuronide
  • estradiol-17 beta-glucuronide affects the localization of and affects the activity of ABCB11 protein
15763547
estradiol-17 beta-glucuronide
  • estradiol-17 beta-glucuronide affects the localization of ABCB11 protein
12702498
estradiol-17 beta-glucuronide
  • estradiol-17 beta-glucuronide affects the localization of ABCB11 protein
12893835
Ethinyl Estradiol
  • Ethinyl Estradiol results in decreased expression of ABCB11 mRNA
17108234
Ethinyl Estradiol
  • Ethinyl Estradiol results in decreased expression of ABCB11 protein
  • Ursodeoxycholic Acid inhibits the reaction [Ethinyl Estradiol results in decreased expression of ABCB11 protein]
12187295
Ethinyl Estradiol
  • Ethinyl Estradiol affects the expression of ABCB11 mRNA
17555576
Ethinyl Estradiol
  • ESR1 protein promotes the reaction [Ethinyl Estradiol results in decreased expression of ABCB11 mRNA]
  • Ethinyl Estradiol results in decreased expression of ABCB11 mRNA
16606610
fluvastatin
  • ABCB11 protein does not affect the import of fluvastatin
  • fluvastatin inhibits the reaction [ABCB11 protein affects the import of Taurocholic Acid]
  • ABCB11 protein does not affect the import of fluvastatin
  • fluvastatin inhibits the reaction [ABCB11 protein affects the import of Taurocholic Acid]
15901796
furan
  • furan results in decreased expression of ABCB11 mRNA
15120968
Fusidic Acid
  • Fusidic Acid results in decreased activity of ABCB11 protein
12106615
Glyburide
  • Glyburide results in decreased activity of ABCB11 protein
15618715
Glyburide
  • Glyburide results in decreased activity of ABCB11 protein
11343252
Glyburide
  • Glyburide results in decreased activity of ABCB11 protein
15465654
Glycochenodeoxycholic Acid
  • ABCB11 protein affects the transport of Glycochenodeoxycholic Acid
15297262
Glycocholic Acid
  • ABCB11 protein affects the transport of Glycocholic Acid
15791618
Glycocholic Acid
  • ABCB11 protein affects the transport of Glycocholic Acid
15297262
glycoursodeoxycholic acid
  • ABCB11 protein affects the transport of glycoursodeoxycholic acid
15297262
guggulu extract
  • guggulu extract results in increased expression of ABCB11 mRNA
12525500
GW 4064
  • [pregna-4,17-diene-3,16-dione co-treated with GW 4064] results in increased expression of ABCB11 mRNA
12525500
GW 4064
  • GW 4064 results in increased expression of ABCB11 mRNA
15644430, 14623915
GW 4064
  • Arachidonic Acid promotes the reaction [GW 4064 results in increased expression of ABCB11 mRNA]
  • Docosahexaenoic Acids promotes the reaction [GW 4064 results in increased expression of ABCB11 mRNA]
  • alpha-Linolenic Acid promotes the reaction [GW 4064 results in increased expression of ABCB11 mRNA]
15307955
GW 4064
  • GW 4064 results in increased expression of ABCB11 mRNA
15911693, 12525500, 15307955, 12519787
GW 4064
  • LG 100268 inhibits the reaction [GW 4064 results in increased expression of ABCB11 mRNA]
12519787
Hydrocortisone
  • Hydrocortisone does not affect the expression of ABCB11 mRNA
12135489
LG 100268
  • LG 100268 inhibits the reaction [Chenodeoxycholic Acid results in increased expression of ABCB11 mRNA]
  • LG 100268 inhibits the reaction [GW 4064 results in increased expression of ABCB11 mRNA]
  • LG 100268 inhibits the reaction [[NR1H4 protein binds to RXRA protein] which binds to ABCB11 promoter]
12519787
Lipopolysaccharides
  • Lipopolysaccharides results in decreased expression of ABCB11 protein
12795754
Lipopolysaccharides
  • Lipopolysaccharides does not affect the expression of ABCB11 mRNA
  • Lipopolysaccharides results in decreased expression of ABCB11 protein
  • Lipopolysaccharides does not affect the expression of ABCB11 mRNA
15205115
Lipopolysaccharides
  • Lipopolysaccharides results in decreased expression of ABCB11 mRNA
15778272, 15312235, 15313196
Lipopolysaccharides
  • Lipopolysaccharides results in decreased expression of ABCB11 mRNA
15205389
Lipopolysaccharides
  • Lipopolysaccharides affects the localization of and results in decreased expression of ABCB11 protein
12706339
Lipopolysaccharides
  • Lipopolysaccharides affects the expression of ABCB11 protein
15778272
Lithocholic Acid
  • ABCB11 protein does not affect the transport of Lithocholic Acid
15297262
Methylmercury Compounds
  • Methylmercury Compounds affects the expression of ABCB11 mRNA
16966085
midecamycin
  • midecamycin results in decreased activity of ABCB11 protein
  • midecamycin results in decreased activity of ABCB11 protein
15618715
Mifepristone
  • Mifepristone results in increased expression of ABCB11 mRNA
15456840
NK 104
  • ABCB11 protein does not affect the import of NK 104
  • NK 104 inhibits the reaction [ABCB11 protein affects the import of Taurocholic Acid]
  • ABCB11 protein does not affect the import of NK 104
  • NK 104 inhibits the reaction [ABCB11 protein affects the import of Taurocholic Acid]
15901796
Paclitaxel
  • ABCB11 protein does not affect the uptake of Paclitaxel
10617675
Phalloidine
  • Phalloidine results in decreased localization of ABCB11 protein
12169763
Phenobarbital
  • Phenobarbital does not affect the expression of ABCB11 mRNA
12135489, 11451172
Phorbol Esters
  • Phorbol Esters promotes the reaction [PRKCA protein results in increased phosphorylation of ABCB11 protein]
11343252
Phorbol Esters
  • Phorbol Esters affects the localization of ABCB11 protein
14679204
Phosphatidylcholines
  • ABCB11 protein results in increased secretion of Phosphatidylcholines
14570929
Phosphatidylcholines
  • Phosphatidylcholines does not affect the expression of ABCB11 protein
12559476
PKI 166
  • PKI 166 metabolite inhibits the reaction [ABCB11 protein affects the uptake of Taurocholic Acid]
  • PKI 166 metabolite results in decreased activity of ABCB11 protein
15280219
Pravastatin
  • ABCB11 protein affects the import of Pravastatin
  • Pravastatin inhibits the reaction [ABCB11 protein affects the import of Taurocholic Acid]
  • ABCB11 protein affects the import of Pravastatin
  • Pravastatin inhibits the reaction [ABCB11 protein affects the import of Taurocholic Acid]
15901796
pregna-4,17-diene-3,16-dione
  • pregna-4,17-diene-3,16-dione inhibits the reaction [Bile Acids and Salts results in increased expression of ABCB11 mRNA]
  • pregna-4,17-diene-3,16-dione inhibits the reaction [NR1H4 protein results in increased expression of ABCB11 mRNA]
12705905
pregna-4,17-diene-3,16-dione
  • [pregna-4,17-diene-3,16-dione co-treated with Chenodeoxycholic Acid] results in increased expression of ABCB11 mRNA
  • [pregna-4,17-diene-3,16-dione co-treated with GW 4064] results in increased expression of ABCB11 mRNA
  • pregna-4,17-diene-3,16-dione results in increased expression of ABCB11 mRNA
12525500
Pregnenolone Carbonitrile
  • Endotoxins inhibits the reaction [Pregnenolone Carbonitrile results in increased expression of ABCB11 mRNA]
  • Pregnenolone Carbonitrile results in increased expression of ABCB11 mRNA
15456840
Reserpine
  • Reserpine does not affect the reaction [ABCB11 protein affects the export of calcein AM]
10617675
Rifampin
  • Rifampin results in decreased expression of ABCB11 mRNA
12135489
rifamycin SV
  • rifamycin SV results in decreased activity of ABCB11 protein
11343252
Ro 47-8634
  • Ro 47-8634 results in decreased activity of ABCB11 protein
11309550
rosuvastatin
  • rosuvastatin inhibits the reaction [ABCB11 protein affects the import of Taurocholic Acid]
  • rosuvastatin inhibits the reaction [ABCB11 protein affects the import of Taurocholic Acid]
15901796
silybin
  • silybin affects the localization of and affects the activity of ABCB11 protein
15763547
simvastatin acid
  • simvastatin acid inhibits the reaction [ABCB11 protein affects the import of Taurocholic Acid]
  • simvastatin acid inhibits the reaction [ABCB11 protein affects the import of Taurocholic Acid]
15901796
sitosterol
  • ABCB11 protein does not affect the transport of sitosterol
12488046
Soybean Oil
  • Soybean Oil does not affect the expression of ABCB11 protein
12559476
Soybean Oil
  • Soybean Oil affects the expression of ABCB11 mRNA
15770074
Spironolactone
  • Spironolactone does not affect the expression of ABCB11 protein
15652244
Streptozocin
  • Streptozocin does not affect the expression of ABCB11 protein
  • Streptozocin results in increased activity of ABCB11 protein
12055592
Tacrolimus
  • Tacrolimus does not affect the localization of ABCB11 protein
12563113
Tamoxifen
  • Tamoxifen results in increased expression of ABCB11 mRNA
12135489
Tamoxifen
  • Tamoxifen results in decreased activity of ABCB11 protein
12739759
Taurine
  • Taurine results in increased expression of ABCB11 protein
12706339
Taurochenodeoxycholic Acid
  • ABCB11 protein affects the transport of Taurochenodeoxycholic Acid
15297262
Taurochenodeoxycholic Acid
  • ABCB11 protein affects the transport of Taurochenodeoxycholic Acid
11343252
Taurochenodeoxycholic Acid
  • Taurochenodeoxycholic Acid results in increased expression of ABCB11 protein
11672435
Taurocholic Acid
  • ABCB11 protein affects the transport of Taurocholic Acid
16039748, 15791618
Taurocholic Acid
  • ABCB11 protein affects the transport of Taurocholic Acid
15297262
Taurocholic Acid
  • ABCB11 protein results in increased secretion of Taurocholic Acid
15209631
Taurocholic Acid
  • ABCB11 protein affects the import of Taurocholic Acid
  • NK 104 inhibits the reaction [ABCB11 protein affects the import of Taurocholic Acid]
  • Pravastatin inhibits the reaction [ABCB11 protein affects the import of Taurocholic Acid]
  • atorvastatin inhibits the reaction [ABCB11 protein affects the import of Taurocholic Acid]
  • cerivastatin inhibits the reaction [ABCB11 protein affects the import of Taurocholic Acid]
  • fluvastatin inhibits the reaction [ABCB11 protein affects the import of Taurocholic Acid]
  • rosuvastatin inhibits the reaction [ABCB11 protein affects the import of Taurocholic Acid]
  • simvastatin acid inhibits the reaction [ABCB11 protein affects the import of Taurocholic Acid]
  • ABCB11 protein affects the import of Taurocholic Acid
  • NK 104 inhibits the reaction [ABCB11 protein affects the import of Taurocholic Acid]
  • Pravastatin inhibits the reaction [ABCB11 protein affects the import of Taurocholic Acid]
  • atorvastatin inhibits the reaction [ABCB11 protein affects the import of Taurocholic Acid]
  • cerivastatin inhibits the reaction [ABCB11 protein affects the import of Taurocholic Acid]
  • fluvastatin inhibits the reaction [ABCB11 protein affects the import of Taurocholic Acid]
  • rosuvastatin inhibits the reaction [ABCB11 protein affects the import of Taurocholic Acid]
  • simvastatin acid inhibits the reaction [ABCB11 protein affects the import of Taurocholic Acid]
15901796
Taurocholic Acid
  • ABCB11 protein affects the export of Taurocholic Acid
11447010
Taurocholic Acid
  • Taurocholic Acid results in increased expression of and results in increased activity of ABCB11 protein
12644037
Taurocholic Acid
  • ABCB11 protein mutant form affects the transport of Taurocholic Acid
14672610
Taurocholic Acid
  • Taurocholic Acid results in increased expression of ABCB11 protein
11113123
Taurocholic Acid
  • ABCB11 protein affects the transport of Taurocholic Acid
15465654, 12518026, 12642476
Taurocholic Acid
  • PKI 166 metabolite inhibits the reaction [ABCB11 protein affects the uptake of Taurocholic Acid]
15280219
Taurocholic Acid
  • ABCB11 protein mutant form does not affect the transport of Taurocholic Acid
16039748
Taurocholic Acid
  • ABCB11 protein affects the transport of Taurocholic Acid
14724752, 12518026, 14672610
Taurocholic Acid
  • ABCB11 protein results in decreased uptake of Taurocholic Acid
10617675
Taurocholic Acid
  • ABCB11 protein affects the secretion of Taurocholic Acid
12865277
Taurodeoxycholic Acid
  • ABCB11 protein results in increased abundance of Taurodeoxycholic Acid
14570929
Taurolithocholic Acid
  • Taurolithocholic Acid affects the localization of ABCB11 protein
12865277
Taurolithocholic Acid
  • Taurolithocholic Acid affects the localization of and affects the activity of ABCB11 protein
15763547
tauromuricholic acid
  • tauromuricholic acid results in increased expression of and results in increased activity of ABCB11 protein
12644037
tauromuricholic acid
  • tauromuricholic acid results in increased expression of ABCB11 protein
11672435
tauroursodeoxycholic acid
  • ABCB11 protein affects the transport of tauroursodeoxycholic acid
15297262
tauroursodeoxycholic acid
  • tauroursodeoxycholic acid results in increased expression of and results in increased activity of ABCB11 protein
12644037
tauroursodeoxycholic acid
  • tauroursodeoxycholic acid results in increased expression of ABCB11 protein
11672435
tert-Butylhydroperoxide
  • 1-(5-Isoquinolinesulfonyl)-2-Methylpiperazine inhibits the reaction [tert-Butylhydroperoxide affects the localization of ABCB11 protein]
  • Bucladesine inhibits the reaction [tert-Butylhydroperoxide affects the localization of ABCB11 protein]
  • tert-Butylhydroperoxide affects the localization of ABCB11 protein
16452108
Tetracycline
  • Tetracycline results in decreased expression of ABCB11 mRNA
17522070
tetrahydroxy-5-cholan-24-oic acid
  • ABCB11 gene mutant form results in increased abundance of tetrahydroxy-5-cholan-24-oic acid
12562825
thymeleatoxin
  • thymeleatoxin affects the localization of ABCB11 protein
14679204
troglitazone
  • troglitazone results in decreased activity of ABCB11 protein
15509663, 15465654
Turpentine
  • Turpentine results in decreased expression of ABCB11 mRNA
15313196
Ursodeoxycholic Acid
  • Ursodeoxycholic Acid results in increased expression of ABCB11 mRNA
  • Ursodeoxycholic Acid results in increased expression of ABCB11 protein
11438506
Ursodeoxycholic Acid
  • Ursodeoxycholic Acid inhibits the reaction [Ethinyl Estradiol results in decreased expression of ABCB11 protein]
12187295
Ursodeoxycholic Acid
  • Ursodeoxycholic Acid results in increased expression of ABCB11 mRNA
14684751
Ursodeoxycholic Acid
  • ABCB11 protein affects the transport of Ursodeoxycholic Acid
15297262
Valinomycin
  • Valinomycin results in decreased activity of ABCB11 protein
12739759
Vanadates
  • Vanadates results in decreased activity of ABCB11 protein
11343252
Vinblastine
  • ABCB11 protein results in decreased uptake of Vinblastine
  • ABCB11 protein results in increased export of Vinblastine
10617675
Vincristine
  • ABCB11 protein does not affect the uptake of Vincristine
10617675
wortmannin
  • wortmannin affects the localization of ABCB11 protein
12702492

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
CHOLESTASIS, PROGRESSIVE FAMILIAL INTRAHEPATIC 2 marker
Carcinoma, Renal Cell inferred via Vincristine 16201981
Hodgkin Disease inferred via Vincristine 17606976, 15147373, 16135485, 16794504
Melanoma, Amelanotic inferred via Vincristine 15990972
Myocardial Infarction inferred via Vincristine 17284715
Hodgkin Disease inferred via Vinblastine 18180244, 18501091
Melanoma inferred via Vinblastine 16809738, 12374674, 18332650, 17761969, 15577323, 18176117, 18505091, 16248763, 16432458, 15577320
Neutropenia inferred via Vinblastine 17378895
Vaginal Neoplasms inferred via Vinblastine 15577323
Cholestasis inferred via Ursodeoxycholic Acid 16487557
Cholestasis, Intrahepatic inferred via Ursodeoxycholic Acid 14728856
Acute-Phase Reaction inferred via Turpentine 16044259
Diabetes Mellitus, Type 2 inferred via troglitazone 16023994
Diabetic Angiopathies inferred via troglitazone 12601628
Hepatitis, Toxic inferred via troglitazone 14986274
Leukemia, Erythroblastic, Acute inferred via troglitazone 16085563
Stomach Neoplasms inferred via troglitazone 15930296
Fatty Liver inferred via Tetracycline 16917069
Hepatitis, Toxic inferred via Tetracycline 17522070
Nephritis, Interstitial inferred via Tetracycline 9884423
Pemphigoid, Bullous inferred via Tetracycline 11026799
Prion Diseases inferred via Tetracycline 10903871
Liver Cirrhosis, Experimental inferred via Taurine 15893842, 15931870
Breast Neoplasms inferred via Tamoxifen 16202921, 17242785, 15565566, 16818667, 11161223, 16873071, 17261762, 15668708, 17440819, 17893378, 17049068
Carcinoma, Hepatocellular inferred via Tamoxifen 16924424
Carcinoma, Transitional Cell inferred via Tamoxifen 17572228
Endometrial Neoplasms inferred via Tamoxifen 16202921, 17893378
Fatty Liver inferred via Tamoxifen 14986274
Female Urogenital Diseases inferred via Tamoxifen 16709447
Lipidoses inferred via Tamoxifen 15342952
Liver Cirrhosis, Experimental inferred via Tamoxifen 18564211
Liver Neoplasms inferred via Tamoxifen 16684651
Mammary Neoplasms, Experimental inferred via Tamoxifen 11731420, 16827153, 14580682
Melanoma inferred via Tamoxifen 12393984
Melanoma, Amelanotic inferred via Tamoxifen 15990972
Spermatocele inferred via Tamoxifen 16709447
Urinary Bladder Neoplasms inferred via Tamoxifen 16712894, 17572228
Duodenal Ulcer inferred via Tacrolimus 17202747
Graft vs Host Disease inferred via Tacrolimus 16376943
Neurodegenerative Diseases inferred via Tacrolimus 15081597
Carcinoid Tumor inferred via Streptozocin 16051944
Diabetes Mellitus inferred via Streptozocin 16285004
Diabetes Mellitus, Experimental inferred via Streptozocin 16286809, 15298345
Liver Cirrhosis, Experimental inferred via silybin 16169303
Lung Neoplasms inferred via silybin 16788158
Mycobacterium Infections inferred via Rifampin 18474467
Tuberculosis inferred via Rifampin 18397238, 15236969
Arteriosclerosis inferred via Reserpine 10729376
Breast Neoplasms inferred via Reserpine 11921183
Hypercholesterolemia inferred via Pravastatin 17188708
Myocardial Infarction inferred via Pravastatin 17188708
Liver Cirrhosis, Experimental inferred via Phosphatidylcholines 16169303
Dystonia inferred via Phenobarbital 1851702
Epilepsy, Absence inferred via Phenobarbital 6401628
Liver Neoplasms inferred via Phenobarbital 15975961, 8742319
Myoclonic Epilepsies, Progressive inferred via Phenobarbital 17484760
Osteomalacia inferred via Phenobarbital 17016548
Pancreatic Neoplasms inferred via Phenobarbital 16965848
Pseudolymphoma inferred via Phenobarbital 12752131
Seizures, Febrile inferred via Phenobarbital 6407741
Breast Neoplasms inferred via Paclitaxel 16244791, 15136595, 11325840, 18323546, 18234424
Carcinoma, Hepatocellular inferred via Paclitaxel 16313753
Liposarcoma inferred via Paclitaxel 17353645
Lymphoma, Non-Hodgkin inferred via Paclitaxel 14749477
Melanoma inferred via Paclitaxel 16342250, 12040289
Multiple Myeloma inferred via Paclitaxel 14749477
Ovarian Neoplasms inferred via Paclitaxel 11161223
Prostatic Neoplasms inferred via Paclitaxel 16356831, 16729912, 17136230
Heart Failure inferred via NK 104 15502390
Endometriosis inferred via Mifepristone 16134523
Ovarian Neoplasms inferred via Mifepristone 16525653
Dementia inferred via Methylmercury Compounds 16140633
Hemolytic-Uremic Syndrome inferred via Lipopolysaccharides 16366002
Inflammation inferred via Lipopolysaccharides 17255318, 17963957
Iron Metabolism Disorders inferred via Lipopolysaccharides 17255318
Respiratory Hypersensitivity inferred via Lipopolysaccharides 10835634
Breast Neoplasms inferred via LG 100268 16818667
Mammary Neoplasms, Experimental inferred via LG 100268 12374698
Cleft Palate inferred via Hydrocortisone 15826874
Neurotoxicity Syndromes inferred via Glyburide 16725203
Coronary Disease inferred via fluvastatin 16142594
Acne Vulgaris inferred via Ethinyl Estradiol 17505938
Adenocarcinoma inferred via Ethinyl Estradiol 14692618
Arteriosclerosis inferred via Ethinyl Estradiol 11256880
Arthritis, Experimental inferred via Ethinyl Estradiol 15885639
Cholestasis inferred via Ethinyl Estradiol 17110522, 11677210, 15861022, 16105132, 17333356, 17681005, 16919318
Encephalomyelitis, Autoimmune, Experimental inferred via Ethinyl Estradiol 12538720
Fatty Liver inferred via Ethinyl Estradiol 15345470
Hypospadias inferred via Ethinyl Estradiol 16569931, 16945680
Infertility, Female inferred via Ethinyl Estradiol 12013081
Infertility, Male inferred via Ethinyl Estradiol 17937319
Panic Disorder inferred via Ethinyl Estradiol 11578682
Pruritus inferred via Ethinyl Estradiol 16919318, 15861022
Spermatocele inferred via Ethinyl Estradiol 16709447
Thrombophilia inferred via Ethinyl Estradiol 11994571
Thrombosis inferred via Ethinyl Estradiol 15669648
Uterine Neoplasms inferred via Ethinyl Estradiol 14692618
Venous Thrombosis inferred via Ethinyl Estradiol 15869587
Breast Neoplasms inferred via Estradiol 17289903, 17018787, 18497071, 17261762, 14630087, 12948864
Candidiasis, Vulvovaginal inferred via Estradiol 16111702
Carcinoma, Hepatocellular inferred via Estradiol 16924424
Herpes Genitalis inferred via Estradiol 15709030
Hot Flashes inferred via Estradiol 17088409
Insulin Resistance inferred via Estradiol 16393666, 16627594
Kidney Diseases inferred via Estradiol 15618244
Kidney Neoplasms inferred via Estradiol 15610895
Liver Cirrhosis, Experimental inferred via Estradiol 14716833, 14659978
Mammary Neoplasms, Experimental inferred via Estradiol 17203775, 11408345, 16891317, 11807958
Myocardial Reperfusion Injury inferred via Estradiol 16810080
Neovascularization, Pathologic inferred via Estradiol 17289903
Prostatic Neoplasms inferred via Estradiol 16740699
Hepatitis, Toxic inferred via Erythromycin Estolate 17522070
Leukemia-Lymphoma, Adult T-Cell inferred via Docosahexaenoic Acids 17077332
Liver Diseases inferred via Docosahexaenoic Acids 17056761
Cholestasis inferred via Diosgenin 16105132
Adenoma inferred via Diethylnitrosamine 10737359
Carcinoma, Hepatocellular inferred via Diethylnitrosamine 16878318, 17428255, 10672840, 10737359, 11831363
Liver Neoplasms inferred via Diethylnitrosamine 2422723, 18648771, 10737359, 16942905, 12112319, 15885732
Liver Neoplasms, Experimental inferred via Diethylnitrosamine 16267830, 3124819, 16842330
Colonic Neoplasms inferred via Dexamethasone 15824018
Liver Cirrhosis, Experimental inferred via Dexamethasone 16718785
Lung Neoplasms inferred via Dexamethasone 15824018, 11195469
Multiple Myeloma inferred via Dexamethasone 15867202, 15744524, 16118317
Respiratory Distress Syndrome, Adult inferred via Dexamethasone 11700416
Colonic Neoplasms inferred via Deoxycholic Acid 16213893
Gingival Hyperplasia inferred via Cyclosporine 8708960
Metal Metabolism, Inborn Errors inferred via Cyclosporine 16801185
Nephrosis, Lipoid inferred via Cyclosporine 17954296
Nephrotic Syndrome inferred via Cyclosporine 18481113
Psoriasis inferred via Cyclosporine 16882103
Liver Neoplasms inferred via Clofibric Acid 17602206
Atherosclerosis inferred via Cholesterol 16632123
Hypercholesterolemia inferred via Cholesterol 16933029
Learning Disorders inferred via Cholesterol 17134702
Niemann-Pick Disease, Type C inferred via Cholesterol 9802331
Hepatitis, Toxic inferred via Chloroform 3104120, 17522070
Tuberculosis inferred via Chenodeoxycholic Acid 16040207
Carbon Tetrachloride Poisoning inferred via Carbon Tetrachloride 16192424, 15673190, 16050911, 16097048, 10355542, 16227642, 16124888, 15700767, 16011737
Fatty Liver inferred via Carbon Tetrachloride 16045604, 61145, 15959796, 17595544, 12795759, 12631006, 16239168
Hepatitis, Toxic inferred via Carbon Tetrachloride 17522070, 16227642, 15027814, 15968718, 15998439, 16177239, 11566570
Hyperbilirubinemia inferred via Carbon Tetrachloride 16899240
Liver Cirrhosis inferred via Carbon Tetrachloride 17174718, 16221502, 17334410, 16239168, 16943688
Liver Cirrhosis, Experimental inferred via Carbon Tetrachloride 16192424, 15925388, 16116963, 17525996, 17557913, 18156304, 16638106, 16027843, 15996030, 16033810, 17565644, 17869086, 17708605, 12667390, 14748882, 13678700, 17900296, 15123356, 18339082, 18429990, 12546737, 18006644, 18481824, 15057751, 12586293, 14512876, 12609069, 18166357, 17922224, 18420326, 15876570, 12445421, 12445418, 15959796, 12389079, 18187930, 18210741, 16015684, 12741479, 14724832, 18472094, 15931870, 17698563, 15893842, 12958196, 17640975, 18412020, 17714472, 18376398, 12898905, 18317297, 17761835, 14620537, 18472332, 14716833, 16136751, 17481882, 18054572, 10355542, 16011737, 18251166, 17823541, 17944888, 18395914, 18279442, 15818738, 17631135, 16097048, 15673190, 12649538, 17721639, 18277467, 18205269, 14716496, 15730626, 12632514, 15052691, 12632512, 17766677, 18418968, 12666154, 18395095, 17976157, 17805973, 16248980
Liver Diseases inferred via Carbon Tetrachloride 16246199, 15830285, 16964402, 15720792, 17285989
Liver Failure inferred via Carbon Tetrachloride 15123358
Liver Failure, Acute inferred via Carbon Tetrachloride 14706259, 16899240
Liver Neoplasms, Experimental inferred via Carbon Tetrachloride 15583823
Hypertension, Pulmonary inferred via bosentan 16219361
Breast Neoplasms inferred via bexarotene 16818667, 16344269
Carcinoma, Non-Small-Cell Lung inferred via bexarotene 16247446
Lung Neoplasms inferred via bexarotene 17849452
Lymphoma, T-Cell, Cutaneous inferred via bexarotene 11161223
Mammary Neoplasms, Experimental inferred via bexarotene 15591091
Coronary Artery Disease inferred via atorvastatin 16368305
Heart Failure inferred via atorvastatin 16360360
Hyperlipoproteinemia Type II inferred via atorvastatin 16238680
Liver Cirrhosis, Experimental inferred via atorvastatin 17347453
Hepatitis, Toxic inferred via Acetaminophen 2444490, 15968718, 16227642, 16177239, 14986274, 17562736, 17522070, 16081117
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215
Liver Cirrhosis, Experimental inferred via 6-ethylchenodeoxycholic acid 15860571, 15980055
Cholestasis, Intrahepatic inferred via 1-Naphthylisothiocyanate 10220858
Hepatitis, Toxic inferred via 1-Naphthylisothiocyanate 17522070
Liver Diseases inferred via 1-Naphthylisothiocyanate 17184895

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Acalovschi M, et al. (2009) "Common variants of ABCB4 and ABCB11 and plasma lipid levels: a study in sib pairs with gallstones, and controls." Lipids. 44(6):521-526. PMID:19408031
  2. [ + ] Saito A, et al. (2009) "Association study between single-nucleotide polymorphisms in 199 drug-related genes and commonly measured quantitative traits of 752 healthy Japanese subjects." J Hum Genet. 54(6):317-323. PMID:19343046
  3. [ + ] Byrne JA, et al. (2009) "Missense mutations and single nucleotide polymorphisms in ABCB11 impair bile salt export pump processing and function or disrupt pre-messenger RNA splicing." Hepatology. 49(2):553-567. PMID:19101985
  4. [ + ] Sabatti C, et al. (2009) "Genome-wide association analysis of metabolic traits in a birth cohort from a founder population." Nat Genet. 41(1):35-46. PMID:19060910
  5. [ + ] Kosters A, et al. (2008) "Bile acid transporters in health and disease." Xenobiotica. 38(7-8):1043-1071. PMID:18668439
  6. [ + ] Lu Y, et al. (2008) "Multiple genetic variants along candidate pathways influence plasma high-density lipoprotein cholesterol concentrations." J Lipid Res. 49(12):2582-2589. PMID:18660489
  7. [ + ] Chen WM, et al. (2008) "Variations in the G6PC2/ABCB11 genomic region are associated with fasting glucose levels." J Clin Invest. 118(7):2620-2628. PMID:18521185
  8. [ + ] Strautnieks SS, et al. (2008) "Severe bile salt export pump deficiency: 82 different ABCB11 mutations in 109 families." Gastroenterology. 134(4):1203-1214. PMID:18395098
  9. [ + ] Meier Y, et al. (2008) "Increased susceptibility for intrahepatic cholestasis of pregnancy and contraceptive-induced cholestasis in carriers of the 1331T>C polymorphism in the bile salt export pump." World J Gastroenterol. 14(1):38-45. PMID:18176959
  10. [ + ] Song X, et al. (2008) "Liver receptor homolog 1 transcriptionally regulates human bile salt export pump expression." J Lipid Res. 49(5):973-984. PMID:18270374
  11. [ + ] Dixon PH, et al. (2008) "Contribution of Variant Alleles of ABCB11 to Susceptibility to Intrahepatic Cholestasis of Pregnancy." Gut. ():. PMID:18987030
  12. [ + ] Chen HL, et al. (2008) "Diagnosis of BSEP/ABCB11 mutations in Asian patients with cholestasis using denaturing high performance liquid chromatography." J Pediatr. 153(6):825-832. PMID:18692205
  13. [ + ] Hosgood HD 3rd, et al. (2008) "Pathway-based evaluation of 380 candidate genes and lung cancer susceptibility suggests the importance of the cell cycle pathway." Carcinogenesis. 29(10):1938-1943. PMID:18676680
  14. [ + ] Ho RH, et al. (2007) "Effect of drug transporter genotypes on pravastatin disposition in European- and African-American participants." Pharmacogenet Genomics. 17(8):647-656. PMID:17622941
  15. [ + ] Lang C, et al. (2007) "Mutations and polymorphisms in the bile salt export pump and the multidrug resistance protein 3 associated with drug-induced liver injury." Pharmacogenet Genomics. 17(1):47-60. PMID:17264802
  16. [ + ] Hirano H, et al. (2006) "High-speed screening and QSAR analysis of human ATP-binding cassette transporter ABCB11 (bile salt export pump) to predict drug-induced intrahepatic cholestasis." Mol Pharm. 3(3):252-265. PMID:16749857
  17. [ + ] Lam CW, et al. (2006) "A patient with novel ABCB11 gene mutations with phenotypic transition between BRIC2 and PFIC2." J Hepatol. 44(1):240-242. PMID:16290310
  18. [ + ] Lang T, et al. (2006) "Genetic variability, haplotype structures, and ethnic diversity of hepatic transporters MDR3 (ABCB4) and bile salt export pump (ABCB11)." Drug Metab Dispos. 34(9):1582-1599. PMID:16763017
  19. [ + ] Knisely AS, et al. (2006) "Hepatocellular carcinoma in ten children under five years of age with bile salt export pump deficiency." Hepatology. 44(2):478-486. PMID:16871584
  20. [ + ] Keitel V, et al. (2006) "Combined mutations of canalicular transporter proteins cause severe intrahepatic cholestasis of pregnancy." Gastroenterology. 131(2):624-629. PMID:16890614
  21. [ + ] Schafmayer C, et al. (2006) "Investigation of the Lith1 candidate genes ABCB11 and LXRA in human gallstone disease." Hepatology. 44(3):650-657. PMID:16941683
  22. [ + ] Hayashi H, et al. (2005) "Two common PFIC2 mutations are associated with the impaired membrane trafficking of BSEP/ABCB11." Hepatology. 41(4):916-924. PMID:15791618
  23. [ + ] Noe J, et al. (2005) "Impaired expression and function of the bile salt export pump due to three novel ABCB11 mutations in intrahepatic cholestasis." J Hepatol. 43(3):536-543. PMID:16039748
  24. [ + ] van Mil SW, et al. (2004) "Benign recurrent intrahepatic cholestasis type 2 is caused by mutations in ABCB11." Gastroenterology. 127(2):379-384. PMID:15300568
  25. [ + ] Ortiz DF, et al. (2004) "Identification of HAX-1 as a protein that binds bile salt export protein and regulates its abundance in the apical membrane of Madin-Darby canine kidney cells." J Biol Chem. 279(31):32761-32770. PMID:15159385
  26. [ + ] Pauli-Magnus C, et al. (2004) "Sequence analysis of bile salt export pump (ABCB11) and multidrug resistance p-glycoprotein 3 (ABCB4, MDR3) in patients with intrahepatic cholestasis of pregnancy." Pharmacogenetics. 14(2):91-102. PMID:15077010
  27. [ + ] Pauli-Magnus C, et al. (2004) "BSEP and MDR3 haplotype structure in healthy Caucasians, primary biliary cirrhosis and primary sclerosing cholangitis." Hepatology. 39(3):779-791. PMID:14999697
  28. [ + ] Kubitz R, et al. (2004) "Trafficking of the bile salt export pump from the Golgi to the canalicular membrane is regulated by the p38 MAP kinase." Gastroenterology. 126(2):541-553. PMID:14762791
  29. [ + ] Ananthanarayanan M, et al. (2004) "Ligand-dependent activation of the farnesoid X-receptor directs arginine methylation of histone H3 by CARM1." J Biol Chem. 279(52):54348-54357. PMID:15471871
  30. [ + ] Eloranta ML, et al. (2003) "Association of single nucleotide polymorphisms of the bile salt export pump gene with intrahepatic cholestasis of pregnancy." Scand J Gastroenterol. 38(6):648-652. PMID:12825874
  31. [ + ] Saito S, et al. (2002) "Three hundred twenty-six genetic variations in genes encoding nine members of ATP-binding cassette, subfamily B (ABCB/MDR/TAP), in the Japanese population." J Hum Genet. 47(1):38-50. PMID:11829140
  32. [ + ] Chen HL, et al. (2002) "FIC1 and BSEP defects in Taiwanese patients with chronic intrahepatic cholestasis with low gamma-glutamyltranspeptidase levels." J Pediatr. 140(1):119-124. PMID:11815775
  33. [ + ] Taylor JC, et al. (2001) "The multidrug resistance P-glycoprotein. Oligomeric state and intramolecular interactions." J Biol Chem. 276(39):36075-36078. PMID:11495894
  34. [ + ] Wang R, et al. (2001) "Targeted inactivation of sister of P-glycoprotein gene (spgp) in mice results in nonprogressive but persistent intrahepatic cholestasis." Proc Natl Acad Sci U S A. 98(4):2011-2016. PMID:11172067
  35. [ + ] Zhang F, et al. (2001) "[Value of P-glycoprotein and glutathione S-transferase-pi as chemo-resistant indicators in ovarian cancers]" Zhonghua Zhong Liu Za Zhi. 23(4):313-316. PMID:11783115
  36. [ + ] Thompson R, et al. (2001) "BSEP: function and role in progressive familial intrahepatic cholestasis." Semin Liver Dis. 21(4):545-550. PMID:11745042
  37. [ + ] Laupeze B, et al. (2001) "Differential expression of the efflux pumps P-glycoprotein and multidrug resistance-associated protein in human monocyte-derived dendritic cells." Hum Immunol. 62(10):1073-1080. PMID:11600213
  38. [ + ] Jansen PL, et al. (1999) "Hepatocanalicular bile salt export pump deficiency in patients with progressive familial intrahepatic cholestasis." Gastroenterology. 117(6):1370-1379. PMID:10579978
  39. [ + ] Gerloff T, et al. (1998) "The sister of P-glycoprotein represents the canalicular bile salt export pump of mammalian liver." J Biol Chem. 273(16):10046-10050. PMID:9545351
  40. [ + ] Strautnieks SS, et al. (1998) "A gene encoding a liver-specific ABC transporter is mutated in progressive familial intrahepatic cholestasis." Nat Genet. 20(3):233-238. PMID:9806540