Abcf1 | GeneID:85493 | Rattus norvegicus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 85493 Official Symbol Abcf1
Locus N/A Gene Type protein-coding
Synonyms Abc50
Full Name ATP-binding cassette, sub-family F (GCN20), member 1
Description ATP-binding cassette, sub-family F (GCN20), member 1
Chromosome 20p12
Also Known As
Summary ATP-binding cassette (ABC) protein family member that associates with eIF2 and ribosomes to facilitate mRNA translation [RGD]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 849

ID Symbol Protein Species
GeneID:23 ABCF1 NP_001020262.1 Homo sapiens
GeneID:32112 CG1703 NP_572736.1 Drosophila melanogaster
GeneID:85493 Abcf1 XP_001062137.1 Rattus norvegicus
GeneID:179748 abcf-1 NP_506192.1 Caenorhabditis elegans
GeneID:224742 Abcf1 NP_038882.1 Mus musculus
GeneID:406467 abcf1 NP_998351.1 Danio rerio
GeneID:462543 ABCF1 NP_001035838.1 Pan troglodytes
GeneID:474826 ABCF1 XP_532056.2 Canis lupus familiaris
GeneID:525343 ABCF1 XP_603695.3 Bos taurus
GeneID:824619 ATGCN4 NP_567001.1 Arabidopsis thaliana
GeneID:1280440 AgaP_AGAP012249 XP_320293.2 Anopheles gambiae
GeneID:2539509 SPCC825.01 NP_588051.1 Schizosaccharomyces pombe
GeneID:4333216 Os03g0441500 NP_001050461.1 Oryza sativa

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005840 Component ribosome
GO:0016887 Function ATPase activity
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding
GO:0043023 Function ribosomal large subunit binding
GO:0043024 Function ribosomal small subunit binding
GO:0006412 Process translation

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001109883  UCSC Browser NP_001103353
2 XM_001056151  UCSC Browser XP_001056151
3 XM_001062137  UCSC Browser XP_001062137

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSRNOT00000001049 MI0003180 hsa-miR-516a-3p UGCUUCCUUUCAGAGGGU
ENSRNOT00000001049 MI0003181 hsa-miR-516a-3p UGCUUCCUUUCAGAGGGU
ENSRNOT00000001049 MI0003180 hsa-miR-516a-5p UUCUCGAGGAAAGAAGCACUUUC
ENSRNOT00000001049 MI0003181 hsa-miR-516a-5p UUCUCGAGGAAAGAAGCACUUUC
ENSRNOT00000001049 MI0003153 hsa-miR-523 GAACGCGCUUCCCUAUAGAGGGU
ENSRNOT00000001049 MI0003582 hsa-miR-575 GAGCCAGUUGGACAGGAGC
ENSRNOT00000001049 MI0003614 hsa-miR-601 UGGUCUAGGAUUGUUGGAGGAG
ENSRNOT00000001049 MI0003637 hsa-miR-623 AUCCCUUGCAGGGGCUGUUGGGU
ENSRNOT00000001049 MI0003639 hsa-miR-625 AGGGGGAAAGUUCUAUAGUCC
ENSRNOT00000001049 MI0003653 hsa-miR-638 AGGGAUCGCGGGCGGGUGGCGGCCU
ENSRNOT00000001049 MI0003662 hsa-miR-647 GUGGCUGCACUCACUUCCUUC
ENSRNOT00000001049 MI0003836 hsa-miR-766 ACUCCAGCCCCACAGCCUCAGC
ENSRNOT00000001049 MI0005757 hsa-miR-935 CCAGUUACCGCUUCCGCUACCGC
ENSRNOT00000001049 MI0005487 mmu-miR-220 CCACCACAGUGUCAGACACUU
ENSRNOT00000001049 MI0002400 mmu-miR-465a-3p GAUCAGGGCCUUUCUAAGUAGA
ENSRNOT00000001049 MI0004553 mmu-miR-666-3p GGCUGCAGCGUGAUCGCCUGCU
ENSRNOT00000001049 MI0004553 mmu-miR-666-5p AGCGGGCACAGCUGUGAGAGCC
ENSRNOT00000001049 MI0004654 mmu-miR-689 CGUCCCCGCUCGGCGGGGUCC
ENSRNOT00000001049 MI0004655 mmu-miR-689 CGUCCCCGCUCGGCGGGGUCC
ENSRNOT00000001049 MI0004699 mmu-miR-714 CGACGAGGGCCGGUCGGUCGC
ENSRNOT00000001049 MI0004704 mmu-miR-717 CUCAGACAGAGAUACCUUCUCU
ENSRNOT00000001049 MI0004516 mmu-miR-763 CCAGCUGGGAAGAACCAGUGGC
ENSRNOT00000001049 MI0000886 rno-miR-101a* UCAGUUAUCACAGUGCUGAUGC
ENSRNOT00000001049 MI0000896 rno-miR-125b-5p UCCCUGAGACCCUAACUUGUGA
ENSRNOT00000001049 MI0000897 rno-miR-125b-5p UCCCUGAGACCCUAACUUGUGA
ENSRNOT00000001049 MI0000616 rno-miR-148b-3p UCAGUGCAUCACAGAACUUUGU
ENSRNOT00000001049 MI0000940 rno-miR-196a* UCGGCAACAAGAAACUGCCUGA
ENSRNOT00000001049 MI0000941 rno-miR-199a-5p CCCAGUGUUCAGACUACCUGUUC
ENSRNOT00000001049 MI0000954 rno-miR-214 ACAGCAGGCACAGACAGGCAG
ENSRNOT00000001049 MI0000851 rno-miR-22* AGUUCUUCAGUGGCAAGCUUUA
ENSRNOT00000001049 MI0000854 rno-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENSRNOT00000001049 MI0000855 rno-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENSRNOT00000001049 MI0000867 rno-miR-30e* CUUUCAGUCGGAUGUUUACAGC
ENSRNOT00000001049 MI0000872 rno-miR-31 AGGCAAGAUGCUGGCAUAGCUG
ENSRNOT00000001049 MI0000626 rno-miR-342-3p UCUCACACAGAAAUCGCACCCGU
ENSRNOT00000001049 MI0003487 rno-miR-377 AUCACACAAAGGCAACUUUUGG
ENSRNOT00000001049 MI0003485 rno-miR-483 UCACUCCUCCCCUCCCGUCUUGU
ENSRNOT00000001049 MI0003540 rno-miR-493 UGAAGGUCUACUGUGUGCCAG
ENSRNOT00000001049 MI0006160 rno-miR-708 AAGGAGCUUACAAUCUAGCUGGG
ENSRNOT00000001049 MI0006117 rno-miR-872 AAGGUUACUUGUUAGUUCAGG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Hurt P, et al. (2004) "The genomic sequence and comparative analysis of the rat major histocompatibility complex." Genome Res. 14(4):631-639. PMID:15060004
  2. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  3. [ + ] Tyzack JK, et al. (2000) "ABC50 interacts with eukaryotic initiation factor 2 and associates with the ribosome in an ATP-dependent manner." J Biol Chem. 275(44):34131-34139. PMID:10931828