ABCC11 | GeneID:85320 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 85320 Official Symbol ABCC11
Locus N/A Gene Type protein-coding
Synonyms EWWD; MRP8; WW
Full Name ATP-binding cassette, sub-family C (CFTR/MRP), member 11
Description ATP-binding cassette, sub-family C (CFTR/MRP), member 11
Chromosome 16q12.1
Also Known As ATP-binding cassette protein C11; ATP-binding cassette transporter MRP8; ATP-binding cassette, sub-family C, member 11; OTTHUMP00000164191; multi-resistance protein 8
Summary The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This ABC full transporter is a member of the MRP subfamily which is involved in multi-drug resistance. The product of this gene participates in physiological processes involving bile acids, conjugated steroids, and cyclic nucleotides. In addition, a SNP in this gene is responsible for determination of human earwax type. This gene and family member ABCC12 are determined to be derived by duplication and are both localized to chromosome 16q12.1. Multiple alternatively spliced transcript variants have been described for this gene. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 69511

ID Symbol Protein Species
GeneID:85320 ABCC11 NP_115972.2 Homo sapiens
GeneID:473275 ABCC11 XP_001163586.1 Pan troglodytes
GeneID:478138 ABCC11 XP_535314.2 Canis lupus familiaris
GeneID:522437 ABCC11 XP_600718.3 Bos taurus

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab20220 MRP8 antibody [MRP8 7C12/4] (ab20220); Mouse monoclonal [MRP8 7C12/4] to MRP8
2 abcam ab19860 MRP8 antibody [2C5/4] (ab19860); Mouse monoclonal [2C5/4] to MRP8
3 abnova H00085320-M02 ABCC11 monoclonal antibody (M02), clone 4H6; Mouse monoclonal antibody raised against a partial recombinant ABCC11.
4 acris AP16811PU-N ABCC11 / MRP8; antibody Ab
5 scbt ABCC11 ABCC11 Antibody / ABCC11 Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of ABCC11 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ABCC11 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0016887 Function ATPase activity
GO:0042626 Function ATPase activity, coupled to transmembrane movement of substances
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_032583  UCSC Browser NP_115972
2 NM_033151  UCSC Browser NP_149163
3 NM_145186  UCSC Browser NP_660187

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000356608 MI0004998 gga-miR-460 CCUGCAUUGUACACACUGUGUG
ENST00000356608 MI0000261 hsa-miR-139-5p UCUACAGUGCACGUGUCUCCAG
ENST00000356608 MI0000477 hsa-miR-146a UGAGAACUGAAUUCCAUGGGUU
ENST00000356608 MI0000253 hsa-miR-148a* AAAGUUCUGAGACACUCCGACU
ENST00000356608 MI0000809 hsa-miR-151-3p CUAGACUGAAGCUCCUUGAGG
ENST00000356608 MI0000809 hsa-miR-151-5p UCGAGGAGCUCACAGUCUAGU
ENST00000356608 MI0000681 hsa-miR-155* CUCCUACAUAUUAGCAUUAACA
ENST00000356608 MI0000289 hsa-miR-181a* ACCAUCGACCGUUGAUUGUACC
ENST00000356608 MI0000272 hsa-miR-182* UGGUUCUAGACUUGCCAACUA
ENST00000356608 MI0000274 hsa-miR-187 UCGUGUCUUGUGUUGCAGCCGG
ENST00000356608 MI0003137 hsa-miR-193b* CGGGGUUUUGAGGGCGAGAUGA
ENST00000356608 MI0000242 hsa-miR-199a-3p ACAGUAGUCUGCACAUUGGUUA
ENST00000356608 MI0000281 hsa-miR-199a-3p ACAGUAGUCUGCACAUUGGUUA
ENST00000356608 MI0000295 hsa-miR-218-2* CAUGGUUCUGUCAAGCACCGCG
ENST00000356608 MI0000078 hsa-miR-22 AAGCUGCCAGUUGAAGAACUGU
ENST00000356608 MI0000298 hsa-miR-221 AGCUACAUUGUCUGCUGGGUUUC
ENST00000356608 MI0000299 hsa-miR-222 AGCUACAUCUGGCUACUGGGU
ENST00000356608 MI0000082 hsa-miR-25 CAUUGCACUUGUCUCGGUCUGA
ENST00000356608 MI0000083 hsa-miR-26a UUCAAGUAAUCCAGGAUAGGCU
ENST00000356608 MI0000750 hsa-miR-26a UUCAAGUAAUCCAGGAUAGGCU
ENST00000356608 MI0000083 hsa-miR-26a-1* CCUAUUCUUGGUUACUUGCACG
ENST00000356608 MI0000084 hsa-miR-26b UUCAAGUAAUUCAGGAUAGGU
ENST00000356608 MI0000085 hsa-miR-27a* AGGGCUUAGCUGCUUGUGAGCA
ENST00000356608 MI0000440 hsa-miR-27b* AGAGCUUAGCUGAUUGGUGAAC
ENST00000356608 MI0000808 hsa-miR-326 CCUCUGGGCCCUUCCUCCAG
ENST00000356608 MI0000816 hsa-miR-335* UUUUUCAUUAUUGCUCCUGACC
ENST00000356608 MI0000806 hsa-miR-337-3p CUCCUAUAUGAUGCCUUUCUUC
ENST00000356608 MI0000742 hsa-miR-34b CAAUCACUAACUCCACUGCCAU
ENST00000356608 MI0000785 hsa-miR-377* AGAGGUUGCCCUUGGUGAAUUC
ENST00000356608 MI0000790 hsa-miR-382 GAAGUUGUUCGUGGUGGAUUCG
ENST00000356608 MI0001445 hsa-miR-423-3p AGCUCGGUCUGAGGCCCCUCAGU
ENST00000356608 MI0001721 hsa-miR-431 UGUCUUGCAGGCCGUCAUGCA
ENST00000356608 MI0001721 hsa-miR-431* CAGGUCGUCUUGCAGGGCUUCU
ENST00000356608 MI0001733 hsa-miR-452* CUCAUCUGCAAAGAAGUAAGUG
ENST00000356608 MI0003132 hsa-miR-493 UGAAGGUCUACUGUGUGCCAGG
ENST00000356608 MI0003184 hsa-miR-500 UAAUCCUUGCUACCUGGGUGAGA
ENST00000356608 MI0003184 hsa-miR-500* AUGCACCUGGGCAAGGAUUCUG
ENST00000356608 MI0003186 hsa-miR-502-3p AAUGCACCUGGGCAAGGAUUCA
ENST00000356608 MI0003186 hsa-miR-502-5p AUCCUUGCUAUCUGGGUGCUA
ENST00000356608 MI0003190 hsa-miR-505* GGGAGCCAGGAAGUAUUGAUGU
ENST00000356608 MI0003144 hsa-miR-515-5p UUCUCCAAAAGAAAGCACUUUCUG
ENST00000356608 MI0003147 hsa-miR-515-5p UUCUCCAAAAGAAAGCACUUUCUG
ENST00000356608 MI0003145 hsa-miR-519e* UUCUCCAAAAGGGAGCACUUUC
ENST00000356608 MI0003150 hsa-miR-526b CUCUUGAGGGAAGCACUUUCUGU
ENST00000356608 MI0005539 hsa-miR-541 UGGUGGGCACAGAAUCUGGACU
ENST00000356608 MI0003568 hsa-miR-562 AAAGUAGCUGUACCAUUUGC
ENST00000356608 MI0003588 hsa-miR-581 UCUUGUGUUCUCUAGAUCAGU
ENST00000356608 MI0003590 hsa-miR-583 CAAAGAGGAAGGUCCCAUUAC
ENST00000356608 MI0003599 hsa-miR-589 UGAGAACCACGUCUGCUCUGAG
ENST00000356608 MI0003618 hsa-miR-605 UAAAUCCCAUGGUGCCUUCUCCU
ENST00000356608 MI0003641 hsa-miR-627 GUGAGUCUCUAAGAAAAGAGGA
ENST00000356608 MI0003652 hsa-miR-637 ACUGGGGGCUUUCGGGCUCUGCGU
ENST00000356608 MI0003664 hsa-miR-649 AAACCUGUGUUGUUCAAGAGUC
ENST00000356608 MI0003676 hsa-miR-654-5p UGGUGGGCCGCAGAACAUGUGC
ENST00000356608 MI0000093 hsa-miR-92a UAUUGCACUUGUCCCGGCCUGU
ENST00000356608 MI0000094 hsa-miR-92a UAUUGCACUUGUCCCGGCCUGU
ENST00000356608 MI0003560 hsa-miR-92b UAUUGCACUCGUCCCGGCCUCC
ENST00000356608 MI0000746 hsa-miR-99b* CAAGCUCGUGUCUGUGGGUCCG
ENST00000356608 MI0005493 mmu-miR-327 ACUUGAGGGGCAUGAGGAU
ENST00000356608 MI0005507 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENST00000356608 MI0005508 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENST00000356608 MI0005509 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENST00000356608 MI0002405 mmu-miR-470 UUCUUGGACUGGCACUGGUGAGU
ENST00000356608 MI0004638 mmu-miR-679 GGACUGUGAGGUGACUCUUGGU
ENST00000356608 MI0004650 mmu-miR-686 AUUGCUUCCCAGACGGUGAAGA
ENST00000356608 MI0004653 mmu-miR-688 UCGCAGGCGACUACUUAUUC
ENST00000356608 MI0005476 mmu-miR-883a-3p UAACUGCAACAGCUCUCAGUAU
ENST00000356608 MI0005477 mmu-miR-883b-3p UAACUGCAACAUCUCUCAGUAU
ENST00000356608 MI0000613 rno-miR-336 UCACCCUUCCAUAUCUAGUCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Dagle JM, et al. (2009) "Determination of genetic predisposition to patent ductus arteriosus in preterm infants." Pediatrics. 123(4):1116-1123. PMID:19336370
  2. [ + ] Guo Y, et al. (2009) "Expression of ABCC-type nucleotide exporters in blasts of adult acute myeloid leukemia: relation to long-term survival." Clin Cancer Res. 15(5):1762-1769. PMID:19240178
  3. [ + ] Viemann D, et al. (2007) "MRP8/MRP14 impairs endothelial integrity and induces a caspase-dependent and -independent cell death program." Blood. 109(6):2453-2460. PMID:17095618
  4. [ + ] Yoshiura K, et al. (2006) "A SNP in the ABCC11 gene is the determinant of human earwax type." Nat Genet. 38(3):324-330. PMID:16444273
  5. [ + ] Bortfeld M, et al. (2006) "Human multidrug resistance protein 8 (MRP8/ABCC11), an apical efflux pump for steroid sulfates, is an axonal protein of the CNS and peripheral nervous system." Neuroscience. 137(4):1247-1257. PMID:16359813
  6. [ + ] Chen ZS, et al. (2005) "Transport of bile acids, sulfated steroids, estradiol 17-beta-D-glucuronide, and leukotriene C4 by human multidrug resistance protein 8 (ABCC11)." Mol Pharmacol. 67(2):545-557. PMID:15537867
  7. [ + ] Vogl T, et al. (2004) "MRP8 and MRP14 control microtubule reorganization during transendothelial migration of phagocytes." Blood. 104(13):4260-4268. PMID:15331440
  8. [ + ] Bouma G, et al. (2004) "Increased serum levels of MRP-8/14 in type 1 diabetes induce an increased expression of CD11b and an enhanced adhesion of circulating monocytes to fibronectin." Diabetes. 53(8):1979-1986. PMID:15277376
  9. [ + ] Guo Y, et al. (2003) "MRP8, ATP-binding cassette C11 (ABCC11), is a cyclic nucleotide efflux pump and a resistance factor for fluoropyrimidines 2',3'-dideoxycytidine and 9'-(2'-phosphonylmethoxyethyl)adenine." J Biol Chem. 278(32):29509-29514. PMID:12764137
  10. [ + ] Lai L, et al. (2002) "Role of glutathione in the multidrug resistance protein 4 (MRP4/ABCC4)-mediated efflux of cAMP and resistance to purine analogues." Biochem J. 361(Pt 3):497-503. PMID:11802779
  11. [ + ] Turriziani O, et al. (2002) "Impaired 2',3'-dideoxy-3'-thiacytidine accumulation in T-lymphoblastoid cells as a mechanism of acquired resistance independent of multidrug resistant protein 4 with a possible role for ATP-binding cassette C11." Biochem J. 368(Pt 1):325-332. PMID:12133003
  12. [ + ] Tomita H, et al. (2002) "Mapping of the wet/dry earwax locus to the pericentromeric region of chromosome 16." Lancet. 359(9322):2000-2002. PMID:12076558
  13. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  14. [ + ] Dean M, et al. (2001) "The human ATP-binding cassette (ABC) transporter superfamily." Genome Res. 11(7):1156-1166. PMID:11435397
  15. [ + ] Tammur J, et al. (2001) "Two new genes from the human ATP-binding cassette transporter superfamily, ABCC11 and ABCC12, tandemly duplicated on chromosome 16q12." Gene. 273(1):89-96. PMID:11483364
  16. [ + ] Striz I, et al. (2001) "MRP 8/14 and procalcitonin serum levels in organ transplantations." Ann Transplant. 6(2):6-9. PMID:11803621
  17. [ + ] Yabuuchi H, et al. (2001) "Multiple splicing variants of two new human ATP-binding cassette transporters, ABCC11 and ABCC12." Biochem Biophys Res Commun. 288(4):933-939. PMID:11688999
  18. [ + ] Bera TK, et al. (2001) "MRP8, a new member of ABC transporter superfamily, identified by EST database mining and gene prediction program, is highly expressed in breast cancer." Mol Med. 7(8):509-516. PMID:11591886