Abcg1 | GeneID:85264 | Rattus norvegicus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 85264 Official Symbol Abcg1
Locus N/A Gene Type protein-coding
Synonyms Abc8
Full Name ATP-binding cassette, sub-family G (WHITE), member 1
Description ATP-binding cassette, sub-family G (WHITE), member 1
Chromosome 20p12
Also Known As
Summary ATP-binding cassette (ABC) half-transporter that facilitates the efflux of excess cholesterol from macrophages and may play an important role in cholesterol homeostasis [RGD]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 21022

ID Symbol Protein Species
GeneID:9619 ABCG1 NP_004906.3 Homo sapiens
GeneID:11307 Abcg1 NP_033723.1 Mus musculus
GeneID:33636 Atet NP_001097078.1 Drosophila melanogaster
GeneID:85264 Abcg1 NP_445954.1 Rattus norvegicus
GeneID:178182 wht-5 NP_502352.1 Caenorhabditis elegans
GeneID:190068 wht-9 NP_499616.1 Caenorhabditis elegans
GeneID:418533 ABCG1 XP_416742.2 Gallus gallus
GeneID:458577 ABCG1 XP_514918.2 Pan troglodytes
GeneID:487777 ABCG1 XP_544902.2 Canis lupus familiaris
GeneID:510745 ABCG1 XP_587930.3 Bos taurus
GeneID:556979 zgc:162197 NP_001103924.1 Danio rerio
GeneID:840064 AT1G31770 NP_564383.1 Arabidopsis thaliana
GeneID:1281268 AgaP_AGAP001858 XP_550960.1 Anopheles gambiae
GeneID:4344750 Os08g0167000 NP_001061077.1 Oryza sativa

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab52617 ABCG1 antibody [EP1366Y] (ab52617); Rabbit monoclonal [EP1366Y] to ABCG1
2 abcam ab36969 ABCG1 antibody (ab36969); Rabbit polyclonal to ABCG1

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005768 Component endosome
GO:0005794 Component Golgi apparatus
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0005886 Component plasma membrane
GO:0043531 Function ADP binding
GO:0016887 Function ATPase activity
GO:0005524 Function ATP binding
GO:0017127 Function cholesterol transporter activity
GO:0034437 Function glycoprotein transporter activity
GO:0000166 Function nucleotide binding
GO:0005548 Function phospholipid transporter activity
GO:0046982 Function protein heterodimerization activity
GO:0042803 Function protein homodimerization activity
GO:0034041 Function sterol-transporting ATPase activity
GO:0019534 Function toxin transporter activity
GO:0042987 Process amyloid precursor protein catabolic process
GO:0033344 Process cholesterol efflux
GO:0042632 Process cholesterol homeostasis
GO:0008203 Process cholesterol metabolic process
GO:0030301 Process cholesterol transport
GO:0034436 Process glycoprotein transport
GO:0032367 Process intracellular cholesterol transport
GO:0033700 Process phospholipid efflux
GO:0055091 Process phospholipid homeostasis
GO:0045542 Process positive regulation of cholesterol biosynthetic process
GO:0045449 Process regulation of transcription
GO:0010033 Process response to organic substance
GO:0043691 Process reverse cholesterol transport
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_053502  UCSC Browser NP_445954

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSRNOT00000001533 MI0003820 hsa-miR-454 UAGUGCAAUAUUGCUUAUAGGGU
ENSRNOT00000001533 MI0003608 hsa-miR-596 AAGCCUGCCCGGCUCCUCGGG
ENSRNOT00000001533 MI0005520 mmu-miR-654-3p UAUGUCUGCUGACCAUCACCUU
ENSRNOT00000001533 MI0000903 rno-miR-130a CAGUGCAAUGUUAAAAGGGCAU
ENSRNOT00000001533 MI0000904 rno-miR-130b CAGUGCAAUGAUGAAAGGGCAU
ENSRNOT00000001533 MI0000972 rno-miR-320 AAAAGCUGGGUUGAGAGGGCGA
ENSRNOT00000001533 MI0000874 rno-miR-33 GUGCAUUGUAGUUGCAUUGCA
ENSRNOT00000001533 MI0000620 rno-miR-339-3p UGAGCGCCUCGACGACAGAGCCA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Sporstol M, et al. (2007) "ABCA1, ABCG1 and SR-BI: hormonal regulation in primary rat hepatocytes and human cell lines." BMC Mol Biol. 8():5. PMID:17241464
  2. [ + ] Hirayama T, et al. (2006) "Hypercholesterolemia in rats with hepatomas: increased oxysterols accelerate efflux but do not inhibit biosynthesis of cholesterol." Hepatology. 44(3):602-611. PMID:16941710
  3. [ + ] Hoekstra M, et al. (2003) "Specific gene expression of ATP-binding cassette transporters and nuclear hormone receptors in rat liver parenchymal, endothelial, and Kupffer cells." J Biol Chem. 278(28):25448-25453. PMID:12704191
  4. [ + ] Schmitz G, et al. (2001) "Role of ABCG1 and other ABCG family members in lipid metabolism." J Lipid Res. 42(10):1513-1520. PMID:11590207