ABHD1 | GeneID:84696 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 84696 Official Symbol ABHD1
Locus N/A Gene Type protein-coding
Synonyms FLJ36128; LABH1
Full Name abhydrolase domain containing 1
Description abhydrolase domain containing 1
Chromosome 2p23.3
Also Known As abhydrolase domain-containing protein 1; lung alpha/beta hydrolase 1
Summary This gene is a member of the AB hydrolase superfamily and encodes a protein with an alpha/beta hydrolase fold. This domain is common to a number of hydrolytic enzymes of widely differing phylogenetic origins and catalytic functions. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 115638

ID Symbol Protein Species
GeneID:84696 ABHD1 NP_115993.2 Homo sapiens
GeneID:313917 Abhd1 NP_001008520.1 Rattus norvegicus
GeneID:470337 ABHD1 XP_525719.2 Pan troglodytes
GeneID:510774 ABHD1 NP_001030266.1 Bos taurus
GeneID:835059 AT5G49950 NP_199806.1 Arabidopsis thaliana
GeneID:2894340 KLLA0E24244g XP_455042.1 Kluyveromyces lactis
GeneID:4619253 AGOS_ABR194C NP_983143.1 Eremothecium gossypii

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab69278 ABHD1 antibody (ab69278); Mouse polyclonal to ABHD1

Exon, Intron and UTRs

Exon, Intron and UTRs of ABHD1 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ABHD1 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0004091 Function carboxylesterase activity
GO:0016787 Function hydrolase activity
GO:0003674 Function molecular_function
GO:0008150 Process biological_process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_032604  UCSC Browser NP_115993

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000316470 MI0000446 hsa-miR-125b UCCCUGAGACCCUAACUUGUGA
ENST00000316470 MI0000470 hsa-miR-125b UCCCUGAGACCCUAACUUGUGA
ENST00000316470 MI0001518 hsa-miR-18b* UGCCCUAAAUGCCCCUUCUGGC
ENST00000316470 MI0003177 hsa-miR-522 AAAAUGGUUCCCUUUAGAGUGU
ENST00000316470 MI0003834 hsa-miR-769-5p UGAGACCUCUGGGUUCUGAGCU
ENST00000316470 MI0005762 hsa-miR-940 AAGGCAGGGCCCCCGCUCCCC
ENST00000316470 MI0005475 mmu-miR-882 AGGAGAGAGUUAGCGCAUUAGU
ENST00000316470 MI0005477 mmu-miR-883b-5p UACUGAGAAUGGGUAGCAGUCA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
pirinixic acid
  • pirinixic acid results in increased expression of ABHD1 mRNA
18301758, 17426115

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Edema inferred via pirinixic acid 12083418
Liver Neoplasms inferred via pirinixic acid 15890375

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Hillier LW, et al. (2005) "Generation and annotation of the DNA sequences of human chromosomes 2 and 4." Nature. 434(7034):724-731. PMID:15815621
  2. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  3. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  4. [ + ] Edgar AJ, et al. (2003) "The gene structure and expression of human ABHD1: overlapping polyadenylation signal sequence with Sec12." BMC Genomics. 4(1):18. PMID:12735795
  5. [ + ] Edgar AJ, et al. (2002) "Cloning and tissue distribution of three murine alpha/beta hydrolase fold protein cDNAs." Biochem Biophys Res Commun. 292(3):617-625. PMID:11922611
  6. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932