Abcd2 | GeneID:84356 | Rattus norvegicus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 84356 Official Symbol Abcd2
Locus N/A Gene Type protein-coding
Synonyms ALDR
Full Name ATP-binding cassette, sub-family D (ALD), member 2
Description ATP-binding cassette, sub-family D (ALD), member 2
Chromosome 7q35
Also Known As
Summary ATP-binding cassette (ABC) peroxisomal half-transporter that assembles with ALDRP to form a functional heterodimer; mutation in ABCD proteins causes X-linked adrenoleukodystrophy [RGD]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 55873

ID Symbol Protein Species
GeneID:225 ABCD2 NP_005155.1 Homo sapiens
GeneID:26874 Abcd2 NP_036124.2 Mus musculus
GeneID:43772 CG2316 NP_726543.1 Drosophila melanogaster
GeneID:84356 Abcd2 NP_203503.1 Rattus norvegicus
GeneID:178527 pmp-4 NP_503105.1 Caenorhabditis elegans
GeneID:417694 ABCD2 XP_415938.2 Gallus gallus
GeneID:466952 ABCD2 XP_522352.2 Pan troglodytes
GeneID:477643 ABCD2 XP_534838.1 Canis lupus familiaris
GeneID:1281041 AgaP_AGAP002071 XP_320975.2 Anopheles gambiae

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0005778 Component peroxisomal membrane
GO:0005777 Component peroxisome
GO:0016887 Function ATPase activity
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding
GO:0005515 Function protein binding
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_033352  UCSC Browser NP_203503

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSRNOT00000021064 MI0004666 mmu-miR-669b AGUUUUGUGUGCAUGUGCAUGU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Wong AW, et al. (2008) "Neurotrophin receptor homolog-2 regulates nerve growth factor signaling." J Neurochem. 106(4):1964-1976. PMID:18624909
  2. [ + ] Gueugnon F, et al. (2007) "Dehydroepiandrosterone up-regulates the Adrenoleukodystrophy-related gene (ABCD2) independently of PPARalpha in rodents." Biochimie. 89(11):1312-1321. PMID:17686565
  3. [ + ] Gueugnon F, et al. (2006) "A novel cell model to study the function of the adrenoleukodystrophy-related protein." Biochem Biophys Res Commun. 341(1):150-157. PMID:16412981
  4. [ + ] Albet S, et al. (2001) "Rat adrenoleukodystrophy-related (ALDR) gene: full-length cDNA sequence and new insight in expression." Biochim Biophys Acta. 1517(2):257-269. PMID:11342107
  5. [ + ] Lombard-Platet G, et al. (1996) "A close relative of the adrenoleukodystrophy (ALD) gene codes for a peroxisomal protein with a specific expression pattern." Proc Natl Acad Sci U S A. 93(3):1265-1269. PMID:8577752