ABHD11 | GeneID:83451 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 83451 Official Symbol ABHD11
Locus N/A Gene Type protein-coding
Synonyms PP1226; WBSCR21
Full Name abhydrolase domain containing 11
Description abhydrolase domain containing 11
Chromosome 7q11.23
Also Known As Williams Beuren syndrome chromosome region 21
Summary This gene encodes a protein containing an alpha/beta hydrolase fold domain. This gene is deleted in Williams syndrome, a multisystem developmental disorder caused by the deletion of contiguous genes at 7q11.23. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 5961

ID Symbol Protein Species
GeneID:31663 CG2059 NP_572388.1 Drosophila melanogaster
GeneID:68758 Abhd11 NP_660250.1 Mus musculus
GeneID:83451 ABHD11 NP_683710.1 Homo sapiens
GeneID:173096 R05D7.4 NP_493077.1 Caenorhabditis elegans
GeneID:185192 F32B4.6 NP_492942.1 Caenorhabditis elegans
GeneID:360831 Abhd11 XP_341105.1 Rattus norvegicus
GeneID:417473 ABHD11 XP_415721.2 Gallus gallus
GeneID:446169 abhd11 NP_001004290.1 Danio rerio
GeneID:472412 ABHD11 XP_001147903.1 Pan troglodytes
GeneID:489803 ABHD11 XP_546921.1 Canis lupus familiaris
GeneID:510109 ABHD11 NP_001029544.1 Bos taurus
GeneID:686139 LOC686139 XP_001066660.1 Rattus norvegicus
GeneID:810986 PF11_0441 XP_001348110.1 Plasmodium falciparum
GeneID:852919 YGR031W NP_011545.1 Saccharomyces cerevisiae
GeneID:1280255 AgaP_AGAP009289 XP_320086.1 Anopheles gambiae
GeneID:2541745 SPAC22H12.03 NP_593115.1 Schizosaccharomyces pombe
GeneID:2685094 MGG_06921 XP_370424.2 Magnaporthe grisea
GeneID:2709957 NCU01454.1 XP_327893.1 Neurospora crassa
GeneID:2897458 KLLA0B05863g XP_451797.1 Kluyveromyces lactis
GeneID:4619344 AGOS_ACL180C NP_983224.1 Eremothecium gossypii

Exon, Intron and UTRs

Exon, Intron and UTRs of ABHD11 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ABHD11 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005575 Component cellular_component
GO:0016787 Function hydrolase activity
GO:0003674 Function molecular_function
GO:0008150 Process biological_process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001145363  UCSC Browser NP_001138835
2 NM_001145364  UCSC Browser NP_001138836
3 NM_148912  UCSC Browser NP_683710
4 NM_148913  UCSC Browser NP_683711
5 NM_148916  UCSC Browser NP_683714
6 NR_026910  UCSC Browser
7 NR_026912  UCSC Browser

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000222800 MI0000434 hsa-let-7i UGAGGUAGUAGUUUGUGCUGUU
ENST00000222800 MI0000113 hsa-miR-106a AAAAGUGCUUACAGUGCAGGUAG
ENST00000222800 MI0000734 hsa-miR-106b UAAAGUGCUGACAGUGCAGAU
ENST00000222800 MI0000266 hsa-miR-10a UACCCUGUAGAUCCGAAUUUGUG
ENST00000222800 MI0000267 hsa-miR-10b UACCCUGUAGAACCGAAUUUGUG
ENST00000222800 MI0000442 hsa-miR-122 UGGAGUGUGACAAUGGUGUUUG
ENST00000222800 MI0000469 hsa-miR-125a-3p ACAGGUGAGGUUCUUGGGAGCC
ENST00000222800 MI0000458 hsa-miR-142-3p UGUAGUGUUUCCUACUUUAUGGA
ENST00000222800 MI0000479 hsa-miR-150 UCUCCCAACCCUUGUACCAGUG
ENST00000222800 MI0000480 hsa-miR-154 UAGGUUAUCCGUGUUGCCUUCG
ENST00000222800 MI0000071 hsa-miR-17 CAAAGUGCUUACAGUGCAGGUAG
ENST00000222800 MI0003137 hsa-miR-193b* CGGGGUUUUGAGGGCGAGAUGA
ENST00000222800 MI0000073 hsa-miR-19a* AGUUUUGCAUAGUUGCACUACA
ENST00000222800 MI0000076 hsa-miR-20a UAAAGUGCUUAUAGUGCAGGUAG
ENST00000222800 MI0001519 hsa-miR-20b CAAAGUGCUCAUAGUGCAGGUAG
ENST00000222800 MI0000290 hsa-miR-214* UGCCUGUCUACACUUGCUGUGC
ENST00000222800 MI0000078 hsa-miR-22* AGUUCUUCAGUGGCAAGCUUUA
ENST00000222800 MI0005529 hsa-miR-220b CCACCACCGUGUCUGACACUU
ENST00000222800 MI0000105 hsa-miR-29b-1* GCUGGUUUCAUAUGGUGGUUUAGA
ENST00000222800 MI0000107 hsa-miR-29b-2* CUGGUUUCACAUGGUGGCUUAG
ENST00000222800 MI0000773 hsa-miR-302c UAAGUGCUUCCAUGUUUCAGUGG
ENST00000222800 MI0000825 hsa-miR-345 GCUGACUCCUAGUCCAGGGCUC
ENST00000222800 MI0000780 hsa-miR-372 AAAGUGCUGCGACAUUUGAGCGU
ENST00000222800 MI0000781 hsa-miR-373 GAAGUGCUUCGAUUUUGGGGUGU
ENST00000222800 MI0000783 hsa-miR-375 UUUGUUCGUUCGGCUCGCGUGA
ENST00000222800 MI0001721 hsa-miR-431 UGUCUUGCAGGCCGUCAUGCA
ENST00000222800 MI0003127 hsa-miR-511 GUGUCUUUUGCUCUGCAGUCA
ENST00000222800 MI0003128 hsa-miR-511 GUGUCUUUUGCUCUGCAGUCA
ENST00000222800 MI0003140 hsa-miR-512-3p AAGUGCUGUCAUAGCUGAGGUC
ENST00000222800 MI0003141 hsa-miR-512-3p AAGUGCUGUCAUAGCUGAGGUC
ENST00000222800 MI0003140 hsa-miR-512-5p CACUCAGCCUUGAGGGCACUUUC
ENST00000222800 MI0003141 hsa-miR-512-5p CACUCAGCCUUGAGGGCACUUUC
ENST00000222800 MI0003144 hsa-miR-515-3p GAGUGCCUUCUUUUGGAGCGUU
ENST00000222800 MI0003147 hsa-miR-515-3p GAGUGCCUUCUUUUGGAGCGUU
ENST00000222800 MI0003162 hsa-miR-519d CAAAGUGCCUCCCUUUAGAGUG
ENST00000222800 MI0003145 hsa-miR-519e AAGUGCCUCCUUUUAGAGUGUU
ENST00000222800 MI0003149 hsa-miR-520a-3p AAAGUGCUUCCCUUUGGACUGU
ENST00000222800 MI0003149 hsa-miR-520a-5p CUCCAGAGGGAAGUACUUUCU
ENST00000222800 MI0003155 hsa-miR-520b AAAGUGCUUCCUUUUAGAGGG
ENST00000222800 MI0003158 hsa-miR-520c-3p AAAGUGCUUCCUUUUAGAGGGU
ENST00000222800 MI0003143 hsa-miR-520e AAAGUGCUUCCUUUUUGAGGG
ENST00000222800 MI0003166 hsa-miR-520g ACAAAGUGCUUCCCUUUAGAGUGU
ENST00000222800 MI0003175 hsa-miR-520h ACAAAGUGCUUCCCUUUAGAGU
ENST00000222800 MI0003150 hsa-miR-526b* GAAAGUGCUUCCUUUUAGAGGC
ENST00000222800 MI0003600 hsa-miR-550 AGUGCCUGAGGGAGUAAGAGCCC
ENST00000222800 MI0003601 hsa-miR-550 AGUGCCUGAGGGAGUAAGAGCCC
ENST00000222800 MI0003613 hsa-miR-600 ACUUACAGACAAGAGCCUUGCUC
ENST00000222800 MI0003617 hsa-miR-604 AGGCUGCGGAAUUCAGGAC
ENST00000222800 MI0003635 hsa-miR-621 GGCUAGCAACAGCGCUUACCU
ENST00000222800 MI0003636 hsa-miR-622 ACAGUCUGCUGAGGUUGGAGC
ENST00000222800 MI0003660 hsa-miR-645 UCUAGGCUGGUACUGCUGA
ENST00000222800 MI0003669 hsa-miR-661 UGCCUGGGUCUCUGGCCUGCGCGU
ENST00000222800 MI0005559 hsa-miR-744* CUGUUGCCACUAACCUCAACCU
ENST00000222800 MI0003836 hsa-miR-766 ACUCCAGCCCCACAGCCUCAGC
ENST00000222800 MI0005716 hsa-miR-924 AGAGUCUUGUGAUGUCUUGC
ENST00000222800 MI0000095 hsa-miR-93 CAAAGUGCUGUUCGUGCAGGUAG
ENST00000222800 MI0005759 hsa-miR-937 AUCCGCGCUCUGACUCUCUGCC
ENST00000222800 MI0002637 mml-miR-189 GUGCCUACUGAGCUGAUAUCAGU
ENST00000222800 MI0000389 mmu-miR-291a-3p AAAGUGCUUCCACUUUGUGUGC
ENST00000222800 MI0000392 mmu-miR-294 AAAGUGCUUCCCUUUUGUGUGU
ENST00000222800 MI0000393 mmu-miR-295 AAAGUGCUACUACUUUUGAGUCU
ENST00000222800 MI0004553 mmu-miR-666-3p GGCUGCAGCGUGAUCGCCUGCU
ENST00000222800 MI0004666 mmu-miR-669b AGUUUUGUGUGCAUGUGCAUGU
ENST00000222800 MI0004643 mmu-miR-681 CAGCCUCGCUGGCAGGCAGCU
ENST00000222800 MI0004662 mmu-miR-693-3p GCAGCUUUCAGAUGUGGCUGUAA
ENST00000222800 MI0004685 mmu-miR-701 UUAGCCGCUGAAAUAGAUGGA
ENST00000222800 MI0004651 mmu-miR-719 AUCUCGGCUACAGAAAAAUGUU
ENST00000222800 MI0004310 mmu-miR-764-5p GGUGCUCACAUGUCCUCCU
ENST00000222800 MI0000644 rno-miR-352 AGAGUAGUAGGUUGCAUAGUA
ENST00000222800 MI0003722 rno-miR-664 UAUUCAUUUACUCCCCAGCCUA
ENST00000222800 MI0003723 rno-miR-664 UAUUCAUUUACUCCCCAGCCUA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Acetaminophen
  • Acetaminophen affects the expression of ABHD11 mRNA
17562736
Carbon Tetrachloride
  • Carbon Tetrachloride results in decreased expression of ABHD11 mRNA
17484886
pirinixic acid
  • pirinixic acid results in increased expression of ABHD11 mRNA
18301758
Progesterone
  • Progesterone results in decreased expression of ABHD11 mRNA
18037150

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Brain Hemorrhage, Traumatic inferred via Progesterone 17868700
Brain Injuries inferred via Progesterone 15665606, 15380490, 15845082
Breast Neoplasms inferred via Progesterone 17614352, 15562024, 16175315
Diabetic Neuropathies inferred via Progesterone 17187935
Encephalomyelitis, Autoimmune, Experimental inferred via Progesterone 17692515
Endometriosis inferred via Progesterone 16134523
Mammary Neoplasms, Experimental inferred via Progesterone 17203775, 11408345
Ovarian Neoplasms inferred via Progesterone 17393432, 16525653
Salivary Gland Neoplasms inferred via Progesterone 18045962
Spinal Cord Injuries inferred via Progesterone 15862959, 16503802
Edema inferred via pirinixic acid 12083418
Liver Neoplasms inferred via pirinixic acid 15890375
Carbon Tetrachloride Poisoning inferred via Carbon Tetrachloride 16192424, 16097048, 15673190, 16050911, 16011737, 15700767, 16124888, 16227642, 10355542
Fatty Liver inferred via Carbon Tetrachloride 16045604, 17595544, 16239168, 15959796, 12795759, 61145, 12631006
Hepatitis, Toxic inferred via Carbon Tetrachloride 17522070, 16177239, 15998439, 15027814, 15968718, 16227642, 11566570
Hyperbilirubinemia inferred via Carbon Tetrachloride 16899240
Liver Cirrhosis inferred via Carbon Tetrachloride 17174718, 16221502, 16239168, 17334410, 16943688
Liver Cirrhosis, Experimental inferred via Carbon Tetrachloride 16192424, 15925388, 17805973, 17525996, 16248980, 16116963, 17557913, 15052691, 12632512, 17766677, 18418968, 12666154, 16638106, 18395095, 18156304, 17976157, 17565644, 17869086, 17708605, 12667390, 14748882, 13678700, 15818738, 17631135, 16097048, 15673190, 12649538, 17721639, 18277467, 18205269, 14716496, 15730626, 12632514, 18429990, 12546737, 18006644, 18481824, 15057751, 12586293, 18054572, 10355542, 16011737, 17922224, 18420326, 15876570, 12445421, 12445418, 15959796, 12898905, 18317297, 17761835, 12389079, 18187930, 18210741, 16015684, 12741479, 14724832, 18472094, 15931870, 17698563, 18376398, 15893842, 12958196, 17640975, 18412020, 17714472, 14512876, 12609069, 18166357, 14620537, 18472332, 14716833, 16136751, 17481882, 17900296, 15123356, 18339082, 18251166, 17823541, 17944888, 18395914, 18279442, 16027843, 15996030, 16033810
Liver Diseases inferred via Carbon Tetrachloride 16246199, 15720792, 17285989, 15830285, 16964402
Liver Failure inferred via Carbon Tetrachloride 15123358
Liver Failure, Acute inferred via Carbon Tetrachloride 14706259, 16899240
Liver Neoplasms, Experimental inferred via Carbon Tetrachloride 15583823
Hepatitis, Toxic inferred via Acetaminophen 2444490, 16081117, 17522070, 17562736, 14986274, 16177239, 16227642, 15968718
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Tsuritani K, et al. (2007) "Distinct class of putative "non-conserved" promoters in humans: comparative studies of alternative promoters of human and mouse genes." Genome Res. 17(7):1005-1014. PMID:17567985
  2. [ + ] Mehrle A, et al. (2006) "The LIFEdb database in 2006." Nucleic Acids Res. 34(Database issue):D415-D418. PMID:16381901
  3. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  4. [ + ] Wiemann S, et al. (2004) "From ORFeome to biology: a functional genomics pipeline." Genome Res. 14(10B):2136-2144. PMID:15489336
  5. [ + ] Wan D, et al. (2004) "Large-scale cDNA transfection screening for genes related to cancer development and progression." Proc Natl Acad Sci U S A. 101(44):15724-15729. PMID:15498874
  6. [ + ] Hillier LW, et al. (2003) "The DNA sequence of human chromosome 7." Nature. 424(6945):157-164. PMID:12853948
  7. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  8. [ + ] Merla G, et al. (2002) "Identification of additional transcripts in the Williams-Beuren syndrome critical region." Hum Genet. 110(5):429-438. PMID:12073013
  9. [ + ] Hartley JL, et al. (2000) "DNA cloning using in vitro site-specific recombination." Genome Res. 10(11):1788-1795. PMID:11076863