FZD1 | GeneID:8321 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 8321 Official Symbol FZD1
Locus N/A Gene Type protein-coding
Synonyms DKFZp564G072; FLJ95923
Full Name frizzled homolog 1 (Drosophila)
Description frizzled homolog 1 (Drosophila)
Chromosome 7q21
Also Known As Wnt receptor; frizzled 1; frizzled, Drosophila, homolog of, 1
Summary Members of the 'frizzled' gene family encode 7-transmembrane domain proteins that are receptors for Wnt signaling proteins. The FZD1 protein contains a signal peptide, a cysteine-rich domain in the N-terminal extracellular region, 7 transmembrane domains, and a C-terminal PDZ domain-binding motif. The FZD1 transcript is expressed in various tissues. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 20750

ID Symbol Protein Species
GeneID:8321 FZD1 NP_003496.1 Homo sapiens
GeneID:14362 Fzd1 NP_067432.2 Mus musculus
GeneID:58868 Fzd1 NP_067089.1 Rattus norvegicus
GeneID:172856 mom-5 NP_492635.1 Caenorhabditis elegans
GeneID:374062 FZD1 NP_001025508.1 Gallus gallus
GeneID:445417 FZD1 XP_600754.2 Bos taurus
GeneID:463524 FZD1 XP_519190.2 Pan troglodytes
GeneID:482294 FZD1 XP_539411.2 Canis lupus familiaris

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab71425 Frizzled homolog 1 antibody - C-terminal (ab71425); Rabbit polyclonal to Frizzled homolog 1 - C-terminal
2 abcam ab71342 Frizzled homolog 1 antibody (ab71342); Rabbit polyclonal to Frizzled homolog 1
3 abgent AP2755c FZD1 Antibody (Center); Purified Rabbit Polyclonal Antibody (Pab)
4 abgent AP2755b FZD1 Antibody (C-term); Purified Rabbit Polyclonal Antibody (Pab)
5 acris SP4142P FZD1; antibody Ab
6 acris AP12393PU-N FZD1 (C-term); antibody Ab
7 acris AP12394PU-N FZD1 (Center); antibody Ab
8 acris AP01266PU-N FZD1; antibody Ab
9 acris AP01203PU-N FZD1; antibody Ab
10 scbt FZD1 FZD1 Antibody / FZD1 Antibodies;
11 sigma F3804 Anti-Frizzled-1 antibody produced in rabbit ;

Exon, Intron and UTRs

Exon, Intron and UTRs of FZD1 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of FZD1 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0004930 Function G-protein coupled receptor activity
GO:0004926 Function non-G-protein coupled 7TM receptor activity
GO:0005515 Function protein binding
GO:0007267 Process cell-cell signaling
GO:0030855 Process epithelial cell differentiation
GO:0007186 Process G-protein coupled receptor protein signaling pathway
GO:0007275 Process multicellular organismal development
GO:0016481 Process negative regulation of transcription
GO:0016055 Process Wnt receptor signaling pathway

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_003505  UCSC Browser NP_003496 Q9UP38   A4D1E8  

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000287934 MI0000737 hsa-miR-200a* CAUCUUACCGGACAGUGCUGGA
ENST00000287934 MI0000342 hsa-miR-200b* CAUCUUACUGGGCAGCAUUGGA
ENST00000287934 MI0000284 hsa-miR-204 UUCCCUUUGUCAUCCUAUGCCU
ENST00000287934 MI0003198 hsa-miR-514 AUUGACACUUCUGUGAGUAGA
ENST00000287934 MI0003199 hsa-miR-514 AUUGACACUUCUGUGAGUAGA
ENST00000287934 MI0003200 hsa-miR-514 AUUGACACUUCUGUGAGUAGA
ENST00000287934 MI0003575 hsa-miR-551b GCGACCCAUACUUGGUUUCAG
ENST00000287934 MI0003624 hsa-miR-611 GCGAGGACCCCUCGGGGUCUGAC
ENST00000287934 MI0000101 hsa-miR-99a AACCCGUAGAUCCGAUCUUGUG
ENST00000287934 MI0005203 mmu-miR-804 UGUGAGUUGUUCCUCACCUGGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
arsenite
  • [arsenite co-treated with Benzo(a)pyrene] results in decreased expression of FZD1 mRNA
  • arsenite results in decreased expression of FZD1 mRNA
15894712
Benzo(a)pyrene
  • Benzo(a)pyrene results in decreased expression of FZD1 mRNA
  • [arsenite co-treated with Benzo(a)pyrene] results in decreased expression of FZD1 mRNA
15894712
bisphenol A
  • bisphenol A results in decreased expression of FZD1 mRNA
12075121
Calcitriol
  • Calcitriol results in increased expression of FZD1 mRNA
16002434
Curcumin
  • Curcumin results in decreased expression of FZD1 mRNA
15713895
Dietary Fats
  • Dietary Fats results in increased expression of FZD1 mRNA
18042831
Ethinyl Estradiol
  • Ethinyl Estradiol results in decreased expression of FZD1 mRNA
17351261, 12075121
Fenretinide
  • Fenretinide results in decreased expression of FZD1 mRNA
16467112
Genistein
  • Genistein results in decreased expression of FZD1 mRNA
12075121
N-(4-methoxyphenyl)retinamide
  • N-(4-methoxyphenyl)retinamide results in decreased expression of FZD1 mRNA
16467112
palm oil
  • palm oil results in increased expression of FZD1 mRNA
18042831
Tetrachlorodibenzodioxin
  • Tetrachlorodibenzodioxin results in increased expression of FZD1 mRNA
15667827

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Adenoma, Liver Cell inferred via Tetrachlorodibenzodioxin 16835633
Carcinoma inferred via Tetrachlorodibenzodioxin 16835633
Cholangiocarcinoma inferred via Tetrachlorodibenzodioxin 16835633
Cleft Palate inferred via Tetrachlorodibenzodioxin 8697196
Diabetes Mellitus, Type 2 inferred via Tetrachlorodibenzodioxin 17107852
Hydronephrosis inferred via Tetrachlorodibenzodioxin 8697196
Liver Neoplasms inferred via Tetrachlorodibenzodioxin 16984957
Skin Neoplasms inferred via N-(4-methoxyphenyl)retinamide 16467112
Breast Neoplasms inferred via Genistein 17200150, 16873071, 16541309
Carcinoma, Hepatocellular inferred via Genistein 16924424
Cardiovascular Diseases inferred via Genistein 16332659
Colonic Neoplasms inferred via Genistein 17182828
Diabetes Mellitus, Type 2 inferred via Genistein 16647724
Endometrial Hyperplasia inferred via Genistein 16402032
Glioblastoma inferred via Genistein 16598420
Liver Cirrhosis, Experimental inferred via Genistein 17823541
Mammary Neoplasms, Experimental inferred via Genistein 14578162, 12929590
Myocardial Infarction inferred via Genistein 17141266
Myocardial Reperfusion Injury inferred via Genistein 17141266
Osteoporosis, Postmenopausal inferred via Genistein 16169203
Prostatic Neoplasms inferred via Genistein 16925846, 15378649, 15256057
Brain Neoplasms inferred via Fenretinide 16187019
Breast Neoplasms inferred via Fenretinide 16601279
Carcinoma, Hepatocellular inferred via Fenretinide 17159502, 16270382
Carcinoma, Squamous Cell inferred via Fenretinide 16274795
Cervical Intraepithelial Neoplasia inferred via Fenretinide 16154183
Colorectal Neoplasms inferred via Fenretinide 17273769
Glioblastoma inferred via Fenretinide 16187019
Leukoplakia, Oral inferred via Fenretinide 16707609
Melanoma inferred via Fenretinide 16270382
Mouth Neoplasms inferred via Fenretinide 16274795
Neoplasms inferred via Fenretinide 17353921, 15958647
Neuronal Ceroid-Lipofuscinoses inferred via Fenretinide 16303764
Ovarian Neoplasms inferred via Fenretinide 16133793
Pancreatic Neoplasms inferred via Fenretinide 15580305
Prostatic Neoplasms inferred via Fenretinide 17024972
Retinal Degeneration inferred via Fenretinide 16303925
Skin Neoplasms inferred via Fenretinide 16467112
Urinary Bladder Neoplasms inferred via Fenretinide 16720286
Uterine Cervical Neoplasms inferred via Fenretinide 16154183
Acne Vulgaris inferred via Ethinyl Estradiol 17505938
Adenocarcinoma inferred via Ethinyl Estradiol 14692618
Arteriosclerosis inferred via Ethinyl Estradiol 11256880
Arthritis, Experimental inferred via Ethinyl Estradiol 15885639
Cholestasis inferred via Ethinyl Estradiol 17110522, 16105132, 11677210, 15861022, 17333356, 16919318, 17681005
Encephalomyelitis, Autoimmune, Experimental inferred via Ethinyl Estradiol 12538720
Fatty Liver inferred via Ethinyl Estradiol 15345470
Hypospadias inferred via Ethinyl Estradiol 16569931, 16945680
Infertility, Female inferred via Ethinyl Estradiol 12013081
Infertility, Male inferred via Ethinyl Estradiol 17937319
Panic Disorder inferred via Ethinyl Estradiol 11578682
Pruritus inferred via Ethinyl Estradiol 16919318, 15861022
Spermatocele inferred via Ethinyl Estradiol 16709447
Thrombophilia inferred via Ethinyl Estradiol 11994571
Thrombosis inferred via Ethinyl Estradiol 15669648
Uterine Neoplasms inferred via Ethinyl Estradiol 14692618
Venous Thrombosis inferred via Ethinyl Estradiol 15869587
Arteriosclerosis inferred via Dietary Fats 15238619
Dyslipidemias inferred via Dietary Fats 18367378
Insulin Resistance inferred via Dietary Fats 18457598
Obesity inferred via Dietary Fats 18457598, 17217161
Breast Neoplasms inferred via Curcumin 16243823
Inflammation inferred via Curcumin 16956363, 17151092
Leukemia-Lymphoma, Adult T-Cell inferred via Curcumin 16106398
Leukemia, T-Cell inferred via Curcumin 16106398
Liver Cirrhosis, Experimental inferred via Curcumin 18006644
Liver Diseases inferred via Curcumin 16956363
Lung Neoplasms inferred via Curcumin 16243823
Lymphoma, T-Cell inferred via Curcumin 16173963
Memory Disorders inferred via Curcumin 17263510
Muscular Atrophy, Spinal inferred via Curcumin 17962980
Respiratory Distress Syndrome, Adult inferred via Curcumin 10666014
Breast Neoplasms inferred via Calcitriol 11237771
Carcinoma, Squamous Cell inferred via Calcitriol 11237771
Encephalomyelitis, Autoimmune, Experimental inferred via Calcitriol 15138306
Prostatic Hyperplasia inferred via Calcitriol 15572423
Prostatic Neoplasms inferred via Calcitriol 12479363, 16644109, 16289102
Breast Neoplasms inferred via bisphenol A 17123778
Carcinoma in Situ inferred via bisphenol A 17123778
Insulin Resistance inferred via bisphenol A 16393666
Prostatic Neoplasms inferred via bisphenol A 16740699
Substance-Related Disorders inferred via bisphenol A 16684133, 16045194
Uterine Diseases inferred via bisphenol A 14652134
Esophageal Neoplasms inferred via Benzo(a)pyrene 16530937
Lung Neoplasms inferred via Benzo(a)pyrene 17053015
Urinary Bladder Neoplasms inferred via Benzo(a)pyrene 17053015
Colonic Neoplasms inferred via arsenite 15037631
Lung Neoplasms inferred via arsenite 16809336
Neovascularization, Pathologic inferred via arsenite 15738583

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
DLG4 DLG4 / FZD1 Two-hybrid Hering H (2002)
WNT3A WNT3A / FZD1 Affinity Capture-Western Gazit A (1999)
WNT5A WNT5A / FZD1 Affinity Capture-Western Gazit A (1999)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Yerges LM, et al. (2009) "Functional Characterization of Genetic Variation in the Frizzled 1 (FZD1) Promoter and Association With Bone Phenotypes: More to the LRP5 Story?" J Bone Miner Res. 24(1):87-96. PMID:18715140
  2. [ + ] Badiglian Filho L, et al. (2009) "Canonical and noncanonical Wnt pathway: a comparison among normal ovary, benign ovarian tumor and ovarian cancer." Oncol Rep. 21(2):313-320. PMID:19148501
  3. [ + ] Quelard D, et al. (2008) "A cryptic frizzled module in cell surface collagen 18 inhibits Wnt/beta-catenin signaling." PLoS ONE. 3(4):e1878. PMID:18382662
  4. [ + ] Dirnberger D, et al. (2007) "Signaling of human frizzled receptors to the mating pathway in yeast." PLoS ONE. 2(9):e954. PMID:17895994
  5. [ + ] Hardie WD, et al. (2007) "Genomic profile of matrix and vasculature remodeling in TGF-alpha induced pulmonary fibrosis." Am J Respir Cell Mol Biol. 37(3):309-321. PMID:17496152
  6. [ + ] Yang L, et al. (2006) "Bone morphogenetic protein-2 modulates Wnt and frizzled expression and enhances the canonical pathway of Wnt signaling in normal keratinocytes." J Dermatol Sci. 42(2):111-119. PMID:16442268
  7. [ + ] Wu J, et al. (2004) "Subcellular localization of frizzled receptors, mediated by their cytoplasmic tails, regulates signaling pathway specificity." PLoS Biol. 2(7):E158. PMID:15252441
  8. [ + ] Zilberberg A, et al. (2004) "The low density lipoprotein receptor-1, LRP1, interacts with the human frizzled-1 (HFz1) and down-regulates the canonical Wnt signaling pathway." J Biol Chem. 279(17):17535-17542. PMID:14739301
  9. [ + ] Omoto S, et al. (2004) "Autosomal dominant familial exudative vitreoretinopathy in two Japanese families with FZD4 mutations (H69Y and C181R)." Ophthalmic Genet. 25(2):81-90. PMID:15370539
  10. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  11. [ + ] Hillier LW, et al. (2003) "The DNA sequence of human chromosome 7." Nature. 424(6945):157-164. PMID:12853948
  12. [ + ] Scherer SW, et al. (2003) "Human chromosome 7: DNA sequence and biology." Science. 300(5620):767-772. PMID:12690205
  13. [ + ] DeCostanzo AJ, et al. (2002) "The Frizzled-1/(beta(2))-adrenergic receptor chimera: pharmacological properties of a unique G protein-linked receptor." Naunyn Schmiedebergs Arch Pharmacol. 365(5):341-348. PMID:12012019
  14. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  15. [ + ] Hering H, et al. (2002) "Direct interaction of Frizzled-1, -2, -4, and -7 with PDZ domains of PSD-95." FEBS Lett. 521(1-3):185-189. PMID:12067714
  16. [ + ] Gazit A, et al. (1999) "Human frizzled 1 interacts with transforming Wnts to transduce a TCF dependent transcriptional response." Oncogene. 18(44):5959-5966. PMID:10557084
  17. [ + ] Tanaka S, et al. (1998) "A novel frizzled gene identified in human esophageal carcinoma mediates APC/beta-catenin signals." Proc Natl Acad Sci U S A. 95(17):10164-10169. PMID:9707618
  18. [ + ] Sagara N, et al. (1998) "Molecular cloning, differential expression, and chromosomal localization of human frizzled-1, frizzled-2, and frizzled-7." Biochem Biophys Res Commun. 252(1):117-122. PMID:9813155