Abcc6 | GeneID:81642 | Rattus norvegicus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 81642 Official Symbol Abcc6
Locus N/A Gene Type protein-coding
Synonyms Mrp6
Full Name ATP-binding cassette, sub-family C (CFTR/MRP), member 6
Description ATP-binding cassette, sub-family C (CFTR/MRP), member 6
Chromosome 1q22
Also Known As liver multidrug resistance-associated protein 6
Summary human homolog acts as a Mg-ATP-dependent efflux pump that transports glutathione S-conjugates and mediates a low level of resistance to some anticancer agents [RGD]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 55559

ID Symbol Protein Species
GeneID:368 ABCC6 NP_001162.3 Homo sapiens
GeneID:27421 Abcc6 NP_061265.1 Mus musculus
GeneID:81642 Abcc6 NP_112275.1 Rattus norvegicus
GeneID:416600 ABCC6 XP_001234744.1 Gallus gallus
GeneID:489993 ABCC6 XP_547113.2 Canis lupus familiaris

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016324 Component apical plasma membrane
GO:0016021 Component integral to membrane
GO:0016328 Component lateral plasma membrane
GO:0016020 Component membrane
GO:0005624 Component membrane fraction
GO:0016887 Function ATPase activity
GO:0042626 Function ATPase activity, coupled to transmembrane movement of substances
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding
GO:0005215 Function transporter activity
GO:0006200 Process ATP catabolic process
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_031013  UCSC Browser NP_112275

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSRNOT00000042115 MI0003593 hsa-miR-548a-3p CAAAACUGGCAAUUACUUUUGC
ENSRNOT00000042115 MI0003598 hsa-miR-548a-3p CAAAACUGGCAAUUACUUUUGC
ENSRNOT00000042115 MI0003612 hsa-miR-548a-3p CAAAACUGGCAAUUACUUUUGC
ENSRNOT00000042115 MI0003650 hsa-miR-635 ACUUGGGCACUGAAACAAUGUCC
ENSRNOT00000042115 MI0003659 hsa-miR-644 AGUGUGGCUUUCUUAGAGC
ENSRNOT00000042115 MI0002402 mmu-miR-467a UAAGUGCCUGCAUGUAUAUGCG
ENSRNOT00000042115 MI0004638 mmu-miR-679 GGACUGUGAGGUGACUCUUGGU
ENSRNOT00000042115 MI0004640 mmu-miR-680 GGGCAUCUGCUGACAUGGGGG
ENSRNOT00000042115 MI0004641 mmu-miR-680 GGGCAUCUGCUGACAUGGGGG
ENSRNOT00000042115 MI0004642 mmu-miR-680 GGGCAUCUGCUGACAUGGGGG
ENSRNOT00000042115 MI0004675 mmu-miR-695 AGAUUGGGCAUAGGUGACUGAA
ENSRNOT00000042115 MI0000835 rno-let-7i UGAGGUAGUAGUUUGUGCUGUU
ENSRNOT00000042115 MI0006130 rno-miR-147 GUGUGCGGAAAUGCUUCUGCUA
ENSRNOT00000042115 MI0000967 rno-miR-296 GAGGGUUGGGUGGAGGCUCUCC
ENSRNOT00000042115 MI0000629 rno-miR-344-5p UCAGGCUCCUGGCUAGAUUCCAGG
ENSRNOT00000042115 MI0001724 rno-miR-433 AUCAUGAUGGGCUCCUCGGUGU
ENSRNOT00000042115 MI0000883 rno-miR-99a AACCCGUAGAUCCGAUCUUGUG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

AB010466   NM_031013   U73038  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Cai J, et al. (2002) "Nucleotide binding and nucleotide hydrolysis properties of the ABC transporter MRP6 (ABCC6)." Biochemistry. 41(25):8058-8067. PMID:12069597
  2. [ + ] Belinsky MG, et al. (2002) "Characterization of the drug resistance and transport properties of multidrug resistance protein 6 (MRP6, ABCC6)." Cancer Res. 62(21):6172-6177. PMID:12414644
  3. [ + ] Ringpfeil F, et al. (2001) "Molecular genetics of pseudoxanthoma elasticum." Exp Dermatol. 10(4):221-228. PMID:11493310
  4. [ + ] Madon J, et al. (2000) "Transport function and hepatocellular localization of mrp6 in rat liver." Mol Pharmacol. 57(3):634-641. PMID:10692506
  5. [ + ] Hirohashi T, et al. (1998) "Hepatic expression of multidrug resistance-associated protein-like proteins maintained in eisai hyperbilirubinemic rats." Mol Pharmacol. 53(6):1068-1075. PMID:9614210