Abat | GeneID:81632 | Rattus norvegicus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 81632 Official Symbol Abat
Locus N/A Gene Type protein-coding
Synonyms Gabat; MGC93392; beta-AlaAT
Full Name 4-aminobutyrate aminotransferase
Description 4-aminobutyrate aminotransferase
Chromosome 10q12
Also Known As GABA aminotransferase
Summary main component of the 4-aminobutyrate (GABA) shunt; major inhibitory neurotransmitter [RGD]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 542

ID Symbol Protein Species
GeneID:18 ABAT NP_000654.2 Homo sapiens
GeneID:40188 CG7433 NP_649168.2 Drosophila melanogaster
GeneID:81632 Abat NP_112265.1 Rattus norvegicus
GeneID:177897 gta-1 NP_501862.1 Caenorhabditis elegans
GeneID:268860 Abat NP_766549.2 Mus musculus
GeneID:378968 abat NP_958906.1 Danio rerio
GeneID:416642 ABAT XP_414940.2 Gallus gallus
GeneID:453903 ABAT XP_001137090.1 Pan troglodytes
GeneID:479856 ABAT XP_851424.1 Canis lupus familiaris
GeneID:506219 ABAT XP_582638.2 Bos taurus
GeneID:852902 UGA1 NP_011533.1 Saccharomyces cerevisiae
GeneID:1270119 AgaP_AGAP006966 XP_308791.2 Anopheles gambiae
GeneID:2542494 SPAC19D5.07 NP_594905.1 Schizosaccharomyces pombe
GeneID:2679339 MGG_01662 XP_363736.1 Magnaporthe grisea
GeneID:2713300 NCU08998.1 XP_331390.1 Neurospora crassa
GeneID:2895485 KLLA0F20548g XP_456003.1 Kluyveromyces lactis
GeneID:4622915 AGOS_AGL050C NP_986616.1 Eremothecium gossypii

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0032144 Component 4-aminobutyrate transaminase complex
GO:0005759 Component mitochondrial matrix
GO:0005739 Component mitochondrion
GO:0019717 Component synaptosome
GO:0003867 Function 4-aminobutyrate transaminase activity
GO:0005515 Function protein binding
GO:0042803 Function protein homodimerization activity
GO:0030170 Function pyridoxal phosphate binding
GO:0047298 Function (S)-3-amino-2-methylpropionate transaminase activity
GO:0032145 Function succinate-semialdehyde dehydrogenase binding
GO:0016740 Function transferase activity
GO:0048148 Process behavioral response to cocaine
GO:0007620 Process copulation
GO:0009450 Process gamma-aminobutyric acid catabolic process
GO:0007626 Process locomotory behavior
GO:0045776 Process negative regulation of blood pressure
GO:0042135 Process neurotransmitter catabolic process
GO:0042220 Process response to cocaine
GO:0042493 Process response to drug
GO:0045471 Process response to ethanol
GO:0001666 Process response to hypoxia
GO:0010039 Process response to iron ion
GO:0035094 Process response to nicotine

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_031003  UCSC Browser NP_112265

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSRNOT00000003633 MI0003198 hsa-miR-514 AUUGACACUUCUGUGAGUAGA
ENSRNOT00000003633 MI0003199 hsa-miR-514 AUUGACACUUCUGUGAGUAGA
ENSRNOT00000003633 MI0003200 hsa-miR-514 AUUGACACUUCUGUGAGUAGA
ENSRNOT00000003633 MI0003569 hsa-miR-563 AGGUUGACAUACGUUUCCC
ENSRNOT00000003633 MI0003578 hsa-miR-571 UGAGUUGGCCAUCUGAGUGAG
ENSRNOT00000003633 MI0003580 hsa-miR-573 CUGAAGUGAUGUGUAACUGAUCAG
ENSRNOT00000003633 MI0003587 hsa-miR-580 UUGAGAAUGAUGAAUCAUUAGG
ENSRNOT00000003633 MI0003594 hsa-miR-586 UAUGCAUUGUAUUUUUAGGUCC
ENSRNOT00000003633 MI0003605 hsa-miR-593 UGUCUCUGCUGGGGUUUCU
ENSRNOT00000003633 MI0004680 mmu-miR-491 AGUGGGGAACCCUUCCAUGAGG
ENSRNOT00000003633 MI0004664 mmu-miR-694 CUGAAAAUGUUGCCUGAAG
ENSRNOT00000003633 MI0004675 mmu-miR-695 AGAUUGGGCAUAGGUGACUGAA
ENSRNOT00000003633 MI0005204 mmu-miR-805 GAAUUGAUCAGGACAUAGGG
ENSRNOT00000003633 MI0000908 rno-miR-135a UAUGGCUUUUUAUUCCUAUGUGA
ENSRNOT00000003633 MI0000645 rno-miR-135b UAUGGCUUUUCAUUCCUAUGUGA
ENSRNOT00000003633 MI0006133 rno-miR-182 UUUGGCAAUGGUAGAACUCACACCG
ENSRNOT00000003633 MI0003541 rno-miR-379 UGGUAGACUAUGGAACGUAGG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

BC081787   D87839   NM_031003   U29701  

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Hirayama T, et al. (2006) "Hypercholesterolemia in rats with hepatomas: increased oxysterols accelerate efflux but do not inhibit biosynthesis of cholesterol." Hepatology. 44(3):602-611. PMID:16941710
  2. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  3. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  4. [ + ] Gardner EL, et al. (2002) "Gamma-vinyl GABA, an irreversible inhibitor of GABA transaminase, alters the acquisition and expression of cocaine-induced sensitization in male rats." Synapse. 46(4):240-250. PMID:12373739
  5. [ + ] Madl JE, et al. (2000) "Glutamate dependence of GABA levels in neurons of hypoxic and hypoglycemic rat hippocampal slices." Neuroscience. 96(4):657-664. PMID:10727784
  6. [ + ] Tamaki N, et al. (2000) "Purification, properties, and sequencing of aminoisobutyrate aminotransferases from rat liver." Methods Enzymol. 324():376-389. PMID:10989446
  7. [ + ] Kobayashi N, et al. (1999) "Changes of GABA metabolic enzymes in acute retinal ischemia." Exp Eye Res. 69(1):91-96. PMID:10375453
  8. [ + ] Kontani Y, et al. (1999) "The mature size of rat 4-aminobutyrate aminotransferase is different in liver and brain." Eur J Biochem. 264(1):218-222. PMID:10447691
  9. [ + ] Dewey SL, et al. (1999) "A pharmacologic strategy for the treatment of nicotine addiction." Synapse. 31(1):76-86. PMID:10025686
  10. [ + ] Engelborghs S, et al. (1998) "Behavioral effects of vigabatrin correlated with whole brain gamma-aminobutyric acid metabolism in audiogenic sensitive rats." Arzneimittelforschung. 48(7):713-716. PMID:9706369
  11. [ + ] Li D, et al. (1998) "Effects of iron deficiency on iron distribution and gamma-aminobutyric acid (GABA) metabolism in young rat brain tissues." Hokkaido Igaku Zasshi. 73(3):215-225. PMID:9719948
  12. [ + ] Honda M, et al. (1998) "Alteration of the GABAergic neuronal system of the retina and superior colliculus in streptozotocin-induced diabetic rat." Kobe J Med Sci. 44(1):1-8. PMID:9846053
  13. [ + ] Mecarelli O, et al. (1997) "Vigabatrin versus carbamazepine and phenytoin in kainic acid-treated pubescent rats." Pharmacol Res. 36(2):87-93. PMID:9344635
  14. [ + ] Kraus P, et al. (1996) "Inhibition of gamma-aminobutyric acid aminotransferase from rat brain mitochondria by chloride and acetate." J Enzyme Inhib. 10(2):125-133. PMID:8835937
  15. [ + ] Seiler N, et al. (1995) "Suppression of haloperidol-induced oral dyskinesias in rats by vigabatrin." Pharmacol Biochem Behav. 50(2):181-189. PMID:7740056
  16. [ + ] Medina-Kauwe LK, et al. (1994) "A rat brain cDNA encodes enzymatically active GABA transaminase and provides a molecular probe for GABA-catabolizing cells." J Neurochem. 62(4):1267-1275. PMID:8133261
  17. [ + ] Sherif F, et al. (1994) "Increase in brain GABA-transaminase activity after chronic ethanol treatment in rats." J Neural Transm Gen Sect. 98(1):69-79. PMID:7710740
  18. [ + ] Sherif F, et al. (1994) "Effects of chronic treatment with the GABA-transaminase inhibitor vigabatrin on exploratory behaviour in rats." Behav Brain Res. 63(1):11-15. PMID:7945972
  19. [ + ] McKenna KF, et al. (1994) "Chronic administration of the antidepressant phenelzine and its N-acetyl analogue: effects on GABAergic function." J Neural Transm Suppl. 41():115-122. PMID:7931216
  20. [ + ] Tsukamoto K, et al. (1993) "Contrasting effects of the GABA transaminase inhibitors gamma-vinylGABA and aminooxyacetic acid on arterial pressure following injection into nucleus tractus solitarius." Neuropharmacology. 32(6):575-579. PMID:8336820
  21. [ + ] Loscher W, et al. (1993) "In vivo administration of valproate reduces the nerve terminal (synaptosomal) activity of GABA aminotransferase in discrete brain areas of rats." Neurosci Lett. 160(2):177-180. PMID:8247350
  22. [ + ] Paredes RG, et al. (1993) "Electromyographic activity of rat ischiocavernosus muscles during copulation after treatment with a GABA-transaminase inhibitor." Behav Neural Biol. 60(2):118-122. PMID:8117236
  23. [ + ] Singewald N, et al. (1992) "Effects of gamma-vinyl GABA (vigabatrin) on blood pressure and body weight of hypertensive and normotensive rats." Naunyn Schmiedebergs Arch Pharmacol. 345(2):181-186. PMID:1570022