ACTN4 | GeneID:81 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 81 Official Symbol ACTN4
Locus N/A Gene Type protein-coding
Synonyms ACTININ-4; DKFZp686K23158; FSGS; FSGS1
Full Name actinin, alpha 4
Description actinin, alpha 4
Chromosome 19q13
Also Known As actinin alpha4 isoform
Summary Alpha actinins belong to the spectrin gene superfamily which represents a diverse group of cytoskeletal proteins, including the alpha and beta spectrins and dystrophins. Alpha actinin is an actin-binding protein with multiple roles in different cell types. In nonmuscle cells, the cytoskeletal isoform is found along microfilament bundles and adherens-type junctions, where it is involved in binding actin to the membrane. In contrast, skeletal, cardiac, and smooth muscle isoforms are localized to the Z-disc and analogous dense bodies, where they help anchor the myofibrillar actin filaments. This gene encodes a nonmuscle, alpha actinin isoform which is concentrated in the cytoplasm, and thought to be involved in metastatic processes. Mutations in this gene have been associated with focal and segmental glomerulosclerosis. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 55857

ID Symbol Protein Species
GeneID:81 ACTN4 NP_004915.2 Homo sapiens
GeneID:60595 Actn4 NP_068695.1 Mus musculus
GeneID:63836 Actn4 NP_113863.2 Rattus norvegicus
GeneID:322221 actn4 NP_955880.1 Danio rerio
GeneID:484526 ACTN4 XP_541640.2 Canis lupus familiaris
GeneID:522269 ACTN4 XP_001252981.1 Bos taurus

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab32816 alpha Actinin 4 antibody [7H6] (ab32816); Mouse monoclonal [7H6] to alpha Actinin 4
2 abcam ab59468 alpha Actinin 4 antibody (ab59468); Rabbit polyclonal to alpha Actinin 4
3 abgent AP7790a ACTN4 Antibody (N-term); Purified Rabbit Polyclonal Antibody (Pab)
4 abgent AP7790b ACTN4 Antibody (C-term); Purified Rabbit Polyclonal Antibody (Pab)
5 abnova H00000081-M01 ACTN4 monoclonal antibody (M01), clone 4D10; Mouse monoclonal antibody raised against a partial recombinant ACTN4.
6 acris AP14583PU-N Alpha-actinin-4 / ACTN4 (N-term); antibody Ab
7 acris AP14584PU-N Alpha-actinin-4 / ACTN4 (C-term); antibody Ab
8 scbt ACTN4 ACTN4 Antibody / ACTN4 Antibodies;
9 sigma HPA001873 Anti-ACTN4 antibody produced in rabbit ;

Exon, Intron and UTRs

Exon, Intron and UTRs of ACTN4 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ACTN4 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0030863 Component cortical cytoskeleton
GO:0005737 Component cytoplasm
GO:0005730 Component nucleolus
GO:0005634 Component nucleus
GO:0048471 Component perinuclear region of cytoplasm
GO:0043234 Component protein complex
GO:0031143 Component pseudopodium
GO:0001725 Component stress fiber
GO:0051015 Function actin filament binding
GO:0005509 Function calcium ion binding
GO:0005178 Function integrin binding
GO:0001882 Function nucleoside binding
GO:0042803 Function protein homodimerization activity
GO:0047485 Function protein N-terminus binding
GO:0051017 Process actin filament bundle formation
GO:0051271 Process negative regulation of cell motion
GO:0051272 Process positive regulation of cell motion
GO:0048549 Process positive regulation of pinocytosis
GO:0032417 Process positive regulation of sodium:hydrogen antiporter activity
GO:0042981 Process regulation of apoptosis
GO:0001666 Process response to hypoxia

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_004924  UCSC Browser NP_004915

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000252699 MI0000443 hsa-miR-124 UAAGGCACGCGGUGAAUGCC
ENST00000252699 MI0000444 hsa-miR-124 UAAGGCACGCGGUGAAUGCC
ENST00000252699 MI0000445 hsa-miR-124 UAAGGCACGCGGUGAAUGCC
ENST00000252699 MI0000458 hsa-miR-142-5p CAUAAAGUAGAAAGCACUACU
ENST00000252699 MI0000463 hsa-miR-153 UUGCAUAGUCACAAAAGUGAUC
ENST00000252699 MI0000464 hsa-miR-153 UUGCAUAGUCACAAAAGUGAUC
ENST00000252699 MI0000480 hsa-miR-154* AAUCAUACACGGUUGACCUAUU
ENST00000252699 MI0000289 hsa-miR-181a* ACCAUCGACCGUUGAUUGUACC
ENST00000252699 MI0000271 hsa-miR-181c* AACCAUCGACCGUUGAGUGGAC
ENST00000252699 MI0003130 hsa-miR-202 AGAGGUAUAGGGCAUGGGAA
ENST00000252699 MI0000813 hsa-miR-324-3p ACUGCCCCAGGUGCUGCUGG
ENST00000252699 MI0000813 hsa-miR-324-5p CGCAUCCCCUAGGGCAUUGGUGU
ENST00000252699 MI0000826 hsa-miR-346 UGUCUGCCCGCAUGCCUGCCUCU
ENST00000252699 MI0000782 hsa-miR-374a UUAUAAUACAACCUGAUAAGUG
ENST00000252699 MI0005566 hsa-miR-374b AUAUAAUACAACCUGCUAAGUG
ENST00000252699 MI0001735 hsa-miR-409-3p GAAUGUUGCUCGGUGAACCCCU
ENST00000252699 MI0003196 hsa-miR-509-5p UACUGCAGACAGUGGCAAUCA
ENST00000252699 MI0005530 hsa-miR-509-5p UACUGCAGACAGUGGCAAUCA
ENST00000252699 MI0003156 hsa-miR-518b CAAAGCGCUCCCCUUUAGAGGU
ENST00000252699 MI0003169 hsa-miR-518e AAAGCGCUUCCCUUCAGAGUG
ENST00000252699 MI0003612 hsa-miR-548a-5p AAAAGUAAUUGCGAGUUUUACC
ENST00000252699 MI0003565 hsa-miR-559 UAAAGUAAAUAUGCACCAAAA
ENST00000252699 MI0003641 hsa-miR-627 GUGAGUCUCUAAGAAAAGAGGA
ENST00000252699 MI0003834 hsa-miR-769-5p UGAGACCUCUGGGUUCUGAGCU
ENST00000252699 MI0005542 hsa-miR-876-3p UGGUGGUUUACAAAGUAAUUCA
ENST00000252699 MI0005538 hsa-miR-892b CACUGGCUCCUUUCUGGGUAGA
ENST00000252699 MI0002401 mmu-miR-466a-3p UAUACAUACACGCACACAUAAGA
ENST00000252699 MI0004638 mmu-miR-679 GGACUGUGAGGUGACUCUUGGU
ENST00000252699 MI0004649 mmu-miR-685 UCAAUGGCUGAGGUGAGGCAC
ENST00000252699 MI0004654 mmu-miR-689 CGUCCCCGCUCGGCGGGGUCC
ENST00000252699 MI0004655 mmu-miR-689 CGUCCCCGCUCGGCGGGGUCC
ENST00000252699 MI0004686 mmu-miR-702 UGCCCACCCUUUACCCCGCUC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Acetaminophen
  • Acetaminophen affects the expression of ACTN4 mRNA
17562736
bromobenzene
  • bromobenzene results in decreased expression of ACTN4 mRNA
15056800
Dietary Fats
  • Dietary Fats results in increased expression of ACTN4 mRNA
18042831
Doxorubicin
  • Doxorubicin affects the localization of ACTN4 protein
16636307
Ethylnitrosourea
  • Ethylnitrosourea results in increased expression of ACTN4 mRNA
15954086
Flavonoids
  • Flavonoids results in decreased expression of ACTN4 mRNA
18035473
hydrazine
  • hydrazine results in increased expression of ACTN4 mRNA
15282401
palm oil
  • palm oil results in increased expression of ACTN4 mRNA
18042831

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Glomerulosclerosis, Focal Segmental marker
Inflammation inferred via Flavonoids 17296493
Brain Diseases inferred via Ethylnitrosourea 14991843
Brain Neoplasms inferred via Ethylnitrosourea 16651633, 16436596, 18412241, 15144691, 16357521
Cell Transformation, Neoplastic inferred via Ethylnitrosourea 16003739
Central Nervous System Neoplasms inferred via Ethylnitrosourea 17160924
Ectodermal Dysplasia inferred via Ethylnitrosourea 18357618
Glioblastoma inferred via Ethylnitrosourea 16436596
Glioma inferred via Ethylnitrosourea 16651633, 18412241, 16357521
Kidney Neoplasms inferred via Ethylnitrosourea 17379185
Lung Neoplasms inferred via Ethylnitrosourea 16271038, 17703301, 16019985
Lymphoma inferred via Ethylnitrosourea 15790496
Mammary Neoplasms, Experimental inferred via Ethylnitrosourea 10838139, 10767621, 18041768
Meningioma inferred via Ethylnitrosourea 17943659
Neoplasms, Experimental inferred via Ethylnitrosourea 16707424
Neurilemmoma inferred via Ethylnitrosourea 17160924, 16003739, 16651423
Oligodendroglioma inferred via Ethylnitrosourea 17160924
Thymus Neoplasms inferred via Ethylnitrosourea 15790496
Adenocarcinoma inferred via Doxorubicin 17418594
Bone Marrow Neoplasms inferred via Doxorubicin 14601052
Brain Neoplasms inferred via Doxorubicin 17150277
Breast Neoplasms inferred via Doxorubicin 15692762, 15939500, 17426702, 16826403, 15567936, 15994142, 15668708, 16264153, 18234424, 17369602, 16935488, 18382427, 18628466, 15136595, 11325840, 16322301, 16096432, 15993339, 15634643, 17983394
Carcinoid Tumor inferred via Doxorubicin 16051944
Carcinoma, Hepatocellular inferred via Doxorubicin 18059187, 16234567, 17876044, 16023760
Carcinoma, Renal Cell inferred via Doxorubicin 16201981
Cardiomyopathies inferred via Doxorubicin 16952015, 15811867, 17308081, 17974986, 16242529, 16364871, 16651473, 17351982, 17131338, 16455267, 18627295, 17329180, 16731534, 15505089, 16278810, 15476868, 16269455, 16109756, 17382496, 17007740
Cardiomyopathy, Dilated inferred via Doxorubicin 17334414, 16243910
Colorectal Neoplasms inferred via Doxorubicin 18259882
Drug Toxicity inferred via Doxorubicin 18602426
Endometrial Neoplasms inferred via Doxorubicin 17359293
Endomyocardial Fibrosis inferred via Doxorubicin 18037988
Glioblastoma inferred via Doxorubicin 17150277
Head and Neck Neoplasms inferred via Doxorubicin 15692506
Heart Diseases inferred via Doxorubicin 16707910, 16244372, 16244371, 16144979, 16879835, 16330681
Hemangiosarcoma inferred via Doxorubicin 15692506
Hepatitis, Toxic inferred via Doxorubicin 17416283
Hodgkin Disease inferred via Doxorubicin 17606976, 15147373, 18501091
Kidney Diseases inferred via Doxorubicin 16775033, 15369732
Kidney Failure inferred via Doxorubicin 17922066
Kidney Failure, Chronic inferred via Doxorubicin 16707910
Leukemia, Erythroblastic, Acute inferred via Doxorubicin 16085563
Liver Cirrhosis, Experimental inferred via Doxorubicin 16595196, 16439617
Liver Neoplasms, Experimental inferred via Doxorubicin 17085340, 16842330
Lung Neoplasms inferred via Doxorubicin 17418594
Lymphoma inferred via Doxorubicin 16098063
Lymphoma, Non-Hodgkin inferred via Doxorubicin 17654614
Lymphoma, T-Cell inferred via Doxorubicin 15621674
Mammary Neoplasms, Experimental inferred via Doxorubicin 15458769
Melanoma inferred via Doxorubicin 16827129
Mucositis inferred via Doxorubicin 17415656
Neoplasm Metastasis inferred via Doxorubicin 18259882
Nephrotic Syndrome inferred via Doxorubicin 15640375, 16889571
Neuroblastoma inferred via Doxorubicin 15555623
Osteosarcoma inferred via Doxorubicin 15930896
Phyllodes Tumor inferred via Doxorubicin 17983394
Prostatic Neoplasms inferred via Doxorubicin 15897917, 16729912, 16888761, 16868541, 18437689, 15749863
Sarcoma inferred via Doxorubicin 18313854, 17710206, 15625365, 15675481, 17203757, 16767912
Sarcoma, Ewing's inferred via Doxorubicin 14601052, 16326096
Sarcoma, Kaposi inferred via Doxorubicin 17846226
Skin Neoplasms inferred via Doxorubicin 15692506
Soft Tissue Neoplasms inferred via Doxorubicin 16767912, 17203757, 15625365
Thyroid Neoplasms inferred via Doxorubicin 17909728, 16010429
Urinary Bladder Neoplasms inferred via Doxorubicin 17653716
Ventricular Dysfunction, Left inferred via Doxorubicin 17334414, 16364871
Arteriosclerosis inferred via Dietary Fats 15238619
Dyslipidemias inferred via Dietary Fats 18367378
Insulin Resistance inferred via Dietary Fats 18457598
Obesity inferred via Dietary Fats 18457598, 17217161
Hepatitis, Toxic inferred via bromobenzene 12628495
Hepatitis, Toxic inferred via Acetaminophen 2444490, 17562736, 16081117, 17522070, 14986274, 16227642, 15968718, 16177239
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215

Gene Interactions

[ - ] BioGRID Gene Product Interaction Database

Symbol Interaction Binary Experiment Source
CAMK2A ACTN4 / CAMK2A Two-hybrid Walikonis RS (2001)
CAMK2A CAMK2A / ACTN4 Two-hybrid Walikonis RS (2001)
CAMK2B ACTN4 / CAMK2B Two-hybrid Walikonis RS (2001)
CAMK2B CAMK2B / ACTN4 Two-hybrid Walikonis RS (2001)
COL17A1 COL17A1 / ACTN4 Affinity Capture-Western Gonzalez AM (2001)
COL17A1 COL17A1 / ACTN4 Two-hybrid Gonzalez AM (2001)
GSN GSN / ACTN4 Reconstituted Complex Renoult C (2001)
Lrrc7 Lrrc7 / ACTN4 Far Western Walikonis RS (2001)
Lrrc7 Lrrc7 / ACTN4 Reconstituted Complex Walikonis RS (2001)
Lrrc7 ACTN4 / Lrrc7 Two-hybrid Walikonis RS (2001)
Lrrc7 Lrrc7 / ACTN4 Two-hybrid Walikonis RS (2001)
MAGI1 MAGI1 / ACTN4 Affinity Capture-Western Patrie KM (2002)
MAGI1 MAGI1 / ACTN4 Reconstituted Complex Patrie KM (2002)
MYOZ1 ACTN4 / MYOZ1 Two-hybrid Rual JF (2005)
MYOZ2 ACTN4 / MYOZ2 Two-hybrid Rual JF (2005)
P2rx7 P2rx7 / ACTN4 Affinity Capture-MS Kim M (2001)
P2rx7 P2rx7 / ACTN4 Affinity Capture-Western Kim M (2001)
PDLIM1 PDLIM1 / ACTN4 Reconstituted Complex Vallenius T (2000)
PDLIM1 ACTN4 / PDLIM1 Two-hybrid Rual JF (2005)
SLC9A3R2 SLC9A3R2 / ACTN4 Affinity Capture-Western Kim JH (2002)
SLC9A3R2 SLC9A3R2 / ACTN4 Reconstituted Complex Kim JH (2002)
TRIM3 TRIM3 / ACTN4 Affinity Capture-Western El-Husseini AE (2000)
TRIM3 TRIM3 / ACTN4 Two-hybrid El-Husseini AE (2000)
USP6NL USP6NL / ACTN4 Affinity Capture-Western Lanzetti L (2004)

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Dai S, et al. (2009) "ACTN4 gene mutations and single nucleotide polymorphisms in idiopathic focal segmental glomerulosclerosis." Nephron Clin Pract. 111(2):c87-c94. PMID:19142020
  2. [ + ] Henderson JM, et al. (2009) "Patients with ACTN4 mutations demonstrate distinctive features of glomerular injury." J Am Soc Nephrol. 20(5):961-968. PMID:19357256
  3. [ + ] Ihalmo P, et al. (2008) "Association analysis of podocyte slit diaphragm genes as candidates for diabetic nephropathy." Diabetologia. 51(1):86-90. PMID:17968527
  4. [ + ] Tonna S, et al. (2008) "The R229Q mutation in NPHS2 may predispose to proteinuria in thin-basement-membrane nephropathy." Pediatr Nephrol. 23(12):2201-2207. PMID:18726620
  5. [ + ] Kikuchi S, et al. (2008) "Expression and gene amplification of actinin-4 in invasive ductal carcinoma of the pancreas." Clin Cancer Res. 14(17):5348-5356. PMID:18765526
  6. [ + ] Kimura M, et al. (2008) "Expression of alpha-actinin-4 in human diabetic nephropathy." Intern Med. 47(12):1099-1106. PMID:18552466
  7. [ + ] Choi HJ, et al. (2008) "Familial focal segmental glomerulosclerosis associated with an ACTN4 mutation and paternal germline mosaicism." Am J Kidney Dis. 51(5):834-838. PMID:18436095
  8. [ + ] Barbolina MV, et al. (2008) "Motility-related actinin alpha-4 is associated with advanced and metastatic ovarian carcinoma." Lab Invest. 88(6):602-614. PMID:18362906
  9. [ + ] Babakov VN, et al. (2008) "RelA/NF-kappaB transcription factor associates with alpha-actinin-4." Exp Cell Res. 314(5):1030-1038. PMID:18215660
  10. [ + ] Hiroi Y, et al. (2008) "Dynamic regulation of endothelial NOS mediated by competitive interaction with alpha-actinin-4 and calmodulin." FASEB J. 22(5):1450-1457. PMID:18180332
  11. [ + ] Lee SH, et al. (2008) "Crystal structure of the actin-binding domain of alpha-actinin-4 Lys255Glu mutant implicated in focal segmental glomerulosclerosis." J Mol Biol. 376(2):317-324. PMID:18164029
  12. [ + ] Barbe L, et al. (2008) "Toward a confocal subcellular atlas of the human proteome." Mol Cell Proteomics. 7(3):499-508. PMID:18029348
  13. [ + ] Prickett TD, et al. (2007) "Cytokine activation of p38 mitogen-activated protein kinase and apoptosis is opposed by alpha-4 targeting of protein phosphatase 2A for site-specific dephosphorylation of MEK3." Mol Cell Biol. 27(12):4217-4227. PMID:17438131
  14. [ + ] Weins A, et al. (2007) "Disease-associated mutant alpha-actinin-4 reveals a mechanism for regulating its F-actin-binding affinity." Proc Natl Acad Sci U S A. 104(41):16080-16085. PMID:17901210
  15. [ + ] Yamamoto S, et al. (2007) "Actinin-4 expression in ovarian cancer: a novel prognostic indicator independent of clinical stage and histological type." Mod Pathol. 20(12):1278-1285. PMID:17873890
  16. [ + ] Kimura K, et al. (2006) "Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes." Genome Res. 16(1):55-65. PMID:16344560
  17. [ + ] Ding Z, et al. (2006) "A retrovirus-based protein complementation assay screen reveals functional AKT1-binding partners." Proc Natl Acad Sci U S A. 103(41):15014-15019. PMID:17018644
  18. [ + ] Chakraborty S, et al. (2006) "Alpha-actinin 4 potentiates myocyte enhancer factor-2 transcription activity by antagonizing histone deacetylase 7." J Biol Chem. 281(46):35070-35080. PMID:16980305
  19. [ + ] Celli L, et al. (2006) "Evidence of a functional role for interaction between ICAM-1 and nonmuscle alpha-actinins in leukocyte diapedesis." J Immunol. 177(6):4113-4121. PMID:16951376
  20. [ + ] Triplett JW, et al. (2006) "Disruption of alpha-actinin-integrin interactions at focal adhesions renders osteoblasts susceptible to apoptosis." Am J Physiol Cell Physiol. 291(5):C909-C921. PMID:16807302
  21. [ + ] Lim J, et al. (2006) "A protein-protein interaction network for human inherited ataxias and disorders of Purkinje cell degeneration." Cell. 125(4):801-814. PMID:16713569
  22. [ + ] Foster LJ, et al. (2006) "Insulin-dependent interactions of proteins with GLUT4 revealed through stable isotope labeling by amino acids in cell culture (SILAC)." J Proteome Res. 5(1):64-75. PMID:16396496
  23. [ + ] Blanchetot C, et al. (2005) "Substrate-trapping techniques in the identification of cellular PTP targets." Methods. 35(1):44-53. PMID:15588985
  24. [ + ] Weins A, et al. (2005) "Mutational and Biological Analysis of alpha-actinin-4 in focal segmental glomerulosclerosis." J Am Soc Nephrol. 16(12):3694-3701. PMID:16251236
  25. [ + ] Rual JF, et al. (2005) "Towards a proteome-scale map of the human protein-protein interaction network." Nature. 437(7062):1173-1178. PMID:16189514
  26. [ + ] Asanuma K, et al. (2005) "Synaptopodin regulates the actin-bundling activity of alpha-actinin in an isoform-specific manner." J Clin Invest. 115(5):1188-1198. PMID:15841212
  27. [ + ] Sako M, et al. (2005) "Analysis of NPHS1, NPHS2, ACTN4, and WT1 in Japanese patients with congenital nephrotic syndrome." Kidney Int. 67(4):1248-1255. PMID:15780077
  28. [ + ] Yan Q, et al. (2005) "CART: an Hrs/actinin-4/BERP/myosin V protein complex required for efficient receptor recycling." Mol Biol Cell. 16(5):2470-2482. PMID:15772161
  29. [ + ] Rush J, et al. (2005) "Immunoaffinity profiling of tyrosine phosphorylation in cancer cells." Nat Biotechnol. 23(1):94-101. PMID:15592455
  30. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  31. [ + ] Menez J, et al. (2004) "Mutant alpha-actinin-4 promotes tumorigenicity and regulates cell motility of a human lung carcinoma." Oncogene. 23(15):2630-2639. PMID:15048094
  32. [ + ] Lin SY, et al. (2004) "The protein-tyrosine phosphatase SHP-1 regulates the phosphorylation of alpha-actinin." J Biol Chem. 279(24):25755-25764. PMID:15070900
  33. [ + ] Lanzetti L, et al. (2004) "Rab5 is a signalling GTPase involved in actin remodelling by receptor tyrosine kinases." Nature. 429(6989):309-314. PMID:15152255
  34. [ + ] Magdolen U, et al. (2004) "Non-muscle alpha-actinin-4 interacts with plasminogen activator inhibitor type-1 (PAI-1)." Biol Chem. 385(9):801-808. PMID:15493875
  35. [ + ] Kigawa A, et al. (2004) "Interaction of the spectrin-like repeats of alpha-actinin-4 with humanin peptide." Clin Exp Nephrol. 8(4):331-338. PMID:15619032
  36. [ + ] Goto H, et al. (2003) "Renal alpha-actinin-4: purification and puromycin aminonucleoside-binding property." Nephron Exp Nephrol. 93(1):e27-e35. PMID:12411747
  37. [ + ] Burgueno J, et al. (2003) "The adenosine A2A receptor interacts with the actin-binding protein alpha-actinin." J Biol Chem. 278(39):37545-37552. PMID:12837758
  38. [ + ] Komatsuda A, et al. (2003) "Analysis of mutations in alpha-actinin 4 and podocin genes of patients with chronic renal failure due to sporadic focal segmental glomerulosclerosis." Ren Fail. 25(1):87-93. PMID:12617336
  39. [ + ] Daniliuc S, et al. (2003) "Hypoxia inactivates inducible nitric oxide synthase in mouse macrophages by disrupting its interaction with alpha-actinin 4." J Immunol. 171(6):3225-3232. PMID:12960352
  40. [ + ] Lukoyanova N, et al. (2002) "Each actin subunit has three nebulin binding sites: implications for steric blocking." Curr Biol. 12(5):383-388. PMID:11882289
  41. [ + ] Kim JH, et al. (2002) "Ca(2+)-dependent inhibition of Na+/H+ exchanger 3 (NHE3) requires an NHE3-E3KARP-alpha-actinin-4 complex for oligomerization and endocytosis." J Biol Chem. 277(26):23714-23724. PMID:11948184
  42. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  43. [ + ] Echchakir H, et al. (2002) "Cytotoxic T lymphocytes directed against a tumor-specific mutated antigen display similar HLA tetramer binding but distinct functional avidity and tissue distribution." Proc Natl Acad Sci U S A. 99(14):9358-9363. PMID:12093915
  44. [ + ] Patrie KM, et al. (2002) "Interaction of two actin-binding proteins, synaptopodin and alpha-actinin-4, with the tight junction protein MAGI-1." J Biol Chem. 277(33):30183-30190. PMID:12042308
  45. [ + ] Echchakir H, et al. (2001) "A point mutation in the alpha-actinin-4 gene generates an antigenic peptide recognized by autologous cytolytic T lymphocytes on a human lung carcinoma." Cancer Res. 61(10):4078-4083. PMID:11358829
  46. [ + ] Gonzalez AM, et al. (2001) "Interactions of a hemidesmosome component and actinin family members." J Cell Sci. 114(Pt 23):4197-4206. PMID:11739652
  47. [ + ] Renoult C, et al. (2001) "Binding of gelsolin domain 2 to actin. An actin interface distinct from that of gelsolin domain 1 and from ADF/cofilin." Eur J Biochem. 268(23):6165-6175. PMID:11733011
  48. [ + ] Huttelmaier S, et al. (2001) "Raver1, a dual compartment protein, is a ligand for PTB/hnRNPI and microfilament attachment proteins." J Cell Biol. 155(5):775-786. PMID:11724819
  49. [ + ] Kim M, et al. (2001) "Proteomic and functional evidence for a P2X7 receptor signalling complex." EMBO J. 20(22):6347-6358. PMID:11707406
  50. [ + ] Xu F, et al. (2001) "Association of tyrosine phosphatase SHP-2 with F-actin at low cell densities." J Biol Chem. 276(31):29479-29484. PMID:11382784