AAAS | GeneID:8086 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 8086 Official Symbol AAAS
Locus N/A Gene Type protein-coding
Synonyms AAA; AAASb; ADRACALA; ADRACALIN; ALADIN; DKFZp586G1624; GL003
Full Name achalasia, adrenocortical insufficiency, alacrimia (Allgrove, triple-A)
Description achalasia, adrenocortical insufficiency, alacrimia (Allgrove, triple-A)
Chromosome 12q13
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 9232

ID Symbol Protein Species
GeneID:8086 AAAS NP_056480.1 Homo sapiens
GeneID:31881 CG16892 NP_572557.1 Drosophila melanogaster
GeneID:223921 Aaas NP_700465.1 Mus musculus
GeneID:378454 aaas NP_998390.1 Danio rerio
GeneID:467003 AAAS XP_522403.2 Pan troglodytes
GeneID:506561 AAAS NP_001068737.1 Bos taurus
GeneID:607867 AAAS XP_849797.1 Canis lupus familiaris
GeneID:824857 AT3G56900 NP_191249.2 Arabidopsis thaliana
GeneID:1272488 AgaP_AGAP010685 XP_311401.2 Anopheles gambiae
GeneID:4349688 Os11g0132700 NP_001065665.1 Oryza sativa

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab56384 Adracalin antibody (ab56384); Mouse monoclonal to Adracalin
2 abnova H00008086-M02 AAAS monoclonal antibody (M02), clone 5A1; Mouse monoclonal antibody raised against a partial recombinant AAAS.
3 scbt AAAS AAAS Antibody / AAAS Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of AAAS Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of AAAS Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005643 Component nuclear pore
GO:0003674 Function molecular_function
GO:0046822 Process regulation of nucleocytoplasmic transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_015665  UCSC Browser NP_056480

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000209873 MI0000469 hsa-miR-125a-3p ACAGGUGAGGUUCUUGGGAGCC
ENST00000209873 MI0000487 hsa-miR-193a-5p UGGGUCUUUGCGGGCGAGAUGA
ENST00000209873 MI0003137 hsa-miR-193b* CGGGGUUUUGAGGGCGAGAUGA
ENST00000209873 MI0000239 hsa-miR-197 UUCACCACCUUCUCCACCCAGC
ENST00000209873 MI0000242 hsa-miR-199a-5p CCCAGUGUUCAGACUACCUGUUC
ENST00000209873 MI0000281 hsa-miR-199a-5p CCCAGUGUUCAGACUACCUGUUC
ENST00000209873 MI0000650 hsa-miR-200c* CGUCUUACCCAGCAGUGUUUGG
ENST00000209873 MI0005529 hsa-miR-220b CCACCACCGUGUCUGACACUU
ENST00000209873 MI0000254 hsa-miR-30c-2* CUGGGAGAAGGCUGUUUACUCU
ENST00000209873 MI0000762 hsa-miR-362-3p AACACACCUAUUCAAGGAUUCA
ENST00000209873 MI0003189 hsa-miR-504 AGACCCUGGUCUGCACUCUAUC
ENST00000209873 MI0005717 hsa-miR-509-3-5p UACUGCAGACGUGGCAAUCAUG
ENST00000209873 MI0003196 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENST00000209873 MI0005530 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENST00000209873 MI0005717 hsa-miR-509-3p UGAUUGGUACGUCUGUGGGUAG
ENST00000209873 MI0003205 hsa-miR-532-5p CAUGCCUUGAGUGUAGGACCGU
ENST00000209873 MI0003662 hsa-miR-647 GUGGCUGCACUCACUUCCUUC
ENST00000209873 MI0003834 hsa-miR-769-3p CUGGGAUCUCCGGGGUCUUGGUU
ENST00000209873 MI0005564 hsa-miR-873 GCAGGAACUUGUGAGUCUCCU
ENST00000209873 MI0001526 mmu-miR-434-5p GCUCGACUCAUGGUUUGAACCA
ENST00000209873 MI0004650 mmu-miR-686 AUUGCUUCCCAGACGGUGAAGA
ENST00000209873 MI0004699 mmu-miR-714 CGACGAGGGCCGGUCGGUCGC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
ACHALASIA-ADDISONIANISM-ALACRIMA SYNDROME marker

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Villanueva-Mendoza C, et al. (2009) "Triple A or Allgrove syndrome. A case report with ophthalmic abnormalities and a novel mutation in the AAAS gene." Ophthalmic Genet. 30(1):45-49. PMID:19172511
  2. [ + ] Menon SK, et al. (2008) "Triple A syndrome." Indian J Pediatr. 75(9):967. PMID:19011813
  3. [ + ] Gilio F, et al. (2007) "Case report of adult-onset Allgrove syndrome." Neurol Sci. 28(6):331-335. PMID:18175081
  4. [ + ] Dusek T, et al. (2006) "A novel AAAS gene mutation (p.R194X) in a patient with triple A syndrome." Horm Res. 65(4):171-176. PMID:16543750
  5. [ + ] Ismail EA, et al. (2006) "Allgrove syndrome with features of familial dysautonomia: a novel mutation in the AAAS gene." Acta Paediatr. 95(9):1140-1143. PMID:16938764
  6. [ + ] Krumbholz M, et al. (2006) "Cellular localization of 17 natural mutant variants of ALADIN protein in triple A syndrome - shedding light on an unexpected splice mutation." Biochem Cell Biol. 84(2):243-249. PMID:16609705
  7. [ + ] Di Nardo G, et al. (2005) "Idiopathic achalasia is not allelic to alacrima achalasia adrenal insufficiency syndrome at the ALADIN locus." Dig Liver Dis. 37(5):312-315. PMID:15843079
  8. [ + ] Brooks BP, et al. (2005) "Genotypic heterogeneity and clinical phenotype in triple A syndrome: a review of the NIH experience 2000-2005." Clin Genet. 68(3):215-221. PMID:16098009
  9. [ + ] Li X, et al. (2005) "Molecular cloning and characterization of AAAS-V2, a novel splice variant of human AAAS." Mol Biol Rep. 32(2):127-131. PMID:16022285
  10. [ + ] Storr HL, et al. (2005) "Identification of the sites of expression of triple A syndrome mRNA in the rat using in situ hybridisation." Neuroscience. 131(1):113-123. PMID:15680696
  11. [ + ] Roubergue A, et al. (2004) "Myoclonus and generalized digestive dysmotility in triple A syndrome with AAAS gene mutation." Mov Disord. 19(3):344-346. PMID:15022193
  12. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  13. [ + ] Brooks BP, et al. (2004) "Triple-A syndrome with prominent ophthalmic features and a novel mutation in the AAAS gene: a case report." BMC Ophthalmol. 4():7. PMID:15217518
  14. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  15. [ + ] Huebner A, et al. (2004) "The triple A syndrome is due to mutations in ALADIN, a novel member of the nuclear pore complex." Endocr Res. 30(4):891-899. PMID:15666842
  16. [ + ] Cronshaw JM, et al. (2003) "The nuclear pore complex protein ALADIN is mislocalized in triple A syndrome." Proc Natl Acad Sci U S A. 100(10):5823-5827. PMID:12730363
  17. [ + ] Prpic I, et al. (2003) "Triple A syndrome: genotype-phenotype assessment." Clin Genet. 63(5):415-417. PMID:12752575
  18. [ + ] Le Rouzic E, et al. (2002) "Docking of HIV-1 Vpr to the nuclear envelope is mediated by the interaction with the nucleoporin hCG1." J Biol Chem. 277(47):45091-45098. PMID:12228227
  19. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  20. [ + ] Goizet C, et al. (2002) "Progressive bulbospinal amyotrophy in triple A syndrome with AAAS gene mutation." Neurology. 58(6):962-965. PMID:11914417
  21. [ + ] Sandrini F, et al. (2001) "Spectrum of mutations of the AAAS gene in Allgrove syndrome: lack of mutations in six kindreds with isolated resistance to corticotropin." J Clin Endocrinol Metab. 86(11):5433-5437. PMID:11701718
  22. [ + ] Schmittmann-Ohters K, et al. (2001) "Clinical and novel molecular findings in a 6.8-year-old Turkish boy with triple A syndrome." Horm Res. 56(1-2):67-72. PMID:11815731
  23. [ + ] Handschug K, et al. (2001) "Triple A syndrome is caused by mutations in AAAS, a new WD-repeat protein gene." Hum Mol Genet. 10(3):283-290. PMID:11159947
  24. [ + ] Tullio-Pelet A, et al. (2000) "Mutant WD-repeat protein in triple-A syndrome." Nat Genet. 26(3):332-335. PMID:11062474
  25. [ + ] Suzuki Y, et al. (1997) "Construction and characterization of a full length-enriched and a 5'-end-enriched cDNA library." Gene. 200(1-2):149-156. PMID:9373149
  26. [ + ] Weber A, et al. (1996) "Linkage of the gene for the triple A syndrome to chromosome 12q13 near the type II keratin gene cluster." Hum Mol Genet. 5(12):2061-2066. PMID:8968764
  27. [ + ] Maruyama K, et al. (1994) "Oligo-capping: a simple method to replace the cap structure of eukaryotic mRNAs with oligoribonucleotides." Gene. 138(1-2):171-174. PMID:8125298