AARSD1 | GeneID:80755 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 80755 Official Symbol AARSD1
Locus N/A Gene Type protein-coding
Synonyms MGC2744
Full Name alanyl-tRNA synthetase domain containing 1
Description alanyl-tRNA synthetase domain containing 1
Chromosome 17q21.31
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 6821

ID Symbol Protein Species
GeneID:31318 CG10802 NP_570062.1 Drosophila melanogaster
GeneID:69684 Aarsd1 NP_659078.1 Mus musculus
GeneID:80755 AARSD1 NP_079543.1 Homo sapiens
GeneID:420013 AARSD1 XP_001235322.1 Gallus gallus
GeneID:445178 zgc:101066 NP_001003572.1 Danio rerio
GeneID:454704 AARSD1 XP_001157692.1 Pan troglodytes
GeneID:480510 AARSD1 XP_537630.2 Canis lupus familiaris
GeneID:510711 MGC134004 NP_001033162.1 Bos taurus
GeneID:619440 Aarsd1 NP_001029281.1 Rattus norvegicus
GeneID:855688 YNL040W NP_014358.1 Saccharomyces cerevisiae
GeneID:1272786 AgaP_AGAP003413 XP_311697.2 Anopheles gambiae
GeneID:2893329 KLLA0D02794g XP_453192.1 Kluyveromyces lactis

Exon, Intron and UTRs

Exon, Intron and UTRs of AARSD1 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of AARSD1 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0004813 Function alanine-tRNA ligase activity
GO:0005524 Function ATP binding
GO:0016876 Function ligase activity, forming aminoacyl-tRNA and related compounds
GO:0003676 Function nucleic acid binding
GO:0000166 Function nucleotide binding
GO:0006419 Process alanyl-tRNA aminoacylation
GO:0006412 Process translation
GO:0043039 Process tRNA aminoacylation

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001136042  UCSC Browser NP_001129514
2 NM_001142653  UCSC Browser NP_001136125
3 NM_001142654  UCSC Browser NP_001136126
4 NM_025267  UCSC Browser NP_079543

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000360221 MI0000060 hsa-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENST00000360221 MI0000061 hsa-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENST00000360221 MI0000062 hsa-let-7a UGAGGUAGUAGGUUGUAUAGUU
ENST00000360221 MI0000063 hsa-let-7b UGAGGUAGUAGGUUGUGUGGUU
ENST00000360221 MI0000064 hsa-let-7c UGAGGUAGUAGGUUGUAUGGUU
ENST00000360221 MI0000065 hsa-let-7d AGAGGUAGUAGGUUGCAUAGUU
ENST00000360221 MI0000066 hsa-let-7e UGAGGUAGGAGGUUGUAUAGUU
ENST00000360221 MI0000434 hsa-let-7i UGAGGUAGUAGUUUGUGCUGUU
ENST00000360221 MI0000469 hsa-miR-125a-5p UCCCUGAGACCCUUUAACCUGUGA
ENST00000360221 MI0000446 hsa-miR-125b UCCCUGAGACCCUAACUUGUGA
ENST00000360221 MI0000470 hsa-miR-125b UCCCUGAGACCCUAACUUGUGA
ENST00000360221 MI0000473 hsa-miR-129-3p AAGCCCUUACCCCAAAAAGCAU
ENST00000360221 MI0000461 hsa-miR-145* GGAUUCCUGGAAAUACUGUUCU
ENST00000360221 MI0000462 hsa-miR-152 UCAGUGCAUGACAGAACUUGG
ENST00000360221 MI0000239 hsa-miR-197 UUCACCACCUUCUCCACCCAGC
ENST00000360221 MI0005529 hsa-miR-220b CCACCACCGUGUCUGACACUU
ENST00000360221 MI0000441 hsa-miR-30b* CUGGGAGGUGGAUGUUUACUUC
ENST00000360221 MI0000807 hsa-miR-323-3p CACAUUACACGGUCGACCUCU
ENST00000360221 MI0001725 hsa-miR-329 AACACACCUGGUUAACCUCUUU
ENST00000360221 MI0001726 hsa-miR-329 AACACACCUGGUUAACCUCUUU
ENST00000360221 MI0000816 hsa-miR-335* UUUUUCAUUAUUGCUCCUGACC
ENST00000360221 MI0000743 hsa-miR-34c-5p AGGCAGUGUAGUUAGCUGAUUGC
ENST00000360221 MI0000762 hsa-miR-362-3p AACACACCUAUUCAAGGAUUCA
ENST00000360221 MI0000764 hsa-miR-363* CGGGUGGAUCACGAUGCAAUUU
ENST00000360221 MI0000785 hsa-miR-377* AGAGGUUGCCCUUGGUGAAUUC
ENST00000360221 MI0000791 hsa-miR-383 AGAUCAGAAGGUGAUUGUGGCU
ENST00000360221 MI0003513 hsa-miR-455-5p UAUGUGCCUUUGGACUACAUCG
ENST00000360221 MI0002471 hsa-miR-487a AAUCAUACAGGGACAUCCAGUU
ENST00000360221 MI0003184 hsa-miR-500 UAAUCCUUGCUACCUGGGUGAGA
ENST00000360221 MI0003190 hsa-miR-505 CGUCAACACUUGCUGGUUUCCU
ENST00000360221 MI0003686 hsa-miR-542-3p UGUGACAGAUUGAUAACUGAAA
ENST00000360221 MI0005565 hsa-miR-543 AAACAUUCGCGGUGCACUUCUU
ENST00000360221 MI0003638 hsa-miR-624 CACAAGGUAUUGGUAUUACCU
ENST00000360221 MI0003650 hsa-miR-635 ACUUGGGCACUGAAACAAUGUCC
ENST00000360221 MI0003517 mmu-miR-546 AUGGUGGCACGGAGUC
ENST00000360221 MI0004693 mmu-miR-709 GGAGGCAGAGGCAGGAGGA
ENST00000360221 MI0004310 mmu-miR-764-3p AGGAGGCCAUAGUGGCAACUGU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Acetaminophen
  • Acetaminophen affects the expression of AARSD1 mRNA
17562736

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Hepatitis, Toxic inferred via Acetaminophen 2444490, 16081117, 17522070, 17562736, 15968718, 16227642, 16177239, 14986274
Hyperalgesia inferred via Acetaminophen 16870215
Liver Failure, Acute inferred via Acetaminophen 16871587, 17185352
Pain inferred via Acetaminophen 16870215

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Kimura K, et al. (2006) "Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes." Genome Res. 16(1):55-65. PMID:16344560
  2. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  3. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  4. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  5. [ + ] Hillier LD, et al. (1996) "Generation and analysis of 280,000 human expressed sequence tags." Genome Res. 6(9):807-828. PMID:8889549
  6. [ + ] Miki Y, et al. (1994) "A strong candidate for the breast and ovarian cancer susceptibility gene BRCA1." Science. 266(5182):66-71. PMID:7545954