ABTB1 | GeneID:80325 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 80325 Official Symbol ABTB1
Locus N/A Gene Type protein-coding
Synonyms BPOZ; Btb3; EF1ABP; MGC20585; PP2259
Full Name ankyrin repeat and BTB (POZ) domain containing 1
Description ankyrin repeat and BTB (POZ) domain containing 1
Chromosome 3q21
Also Known As elongation factor 1A binding protein
Summary This gene encodes a protein with an ankyrin repeat region and two BTB/POZ domains, which are thought to be involved in protein-protein interactions. Expression of this gene is activated by the phosphatase and tensin homolog, a tumor suppressor. Alternate splicing results in three transcript variants encoding different isoforms. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 32731

ID Symbol Protein Species
GeneID:80283 Abtb1 NP_084527.1 Mus musculus
GeneID:80325 ABTB1 NP_742024.1 Homo sapiens
GeneID:297432 Abtb1 NP_001005902.1 Rattus norvegicus
GeneID:416026 ABTB1 NP_001025769.1 Gallus gallus
GeneID:507417 ABTB1 XP_584015.2 Bos taurus
GeneID:609299 ABTB1 XP_851631.1 Canis lupus familiaris
GeneID:796990 LOC796990 XP_001337407.2 Danio rerio
GeneID:815017 AT2G04740 NP_178551.2 Arabidopsis thaliana
GeneID:854816 YIL001W NP_012265.1 Saccharomyces cerevisiae
GeneID:2542872 btb3 NP_593682.1 Schizosaccharomyces pombe
GeneID:2682580 MGG_03027 XP_366951.2 Magnaporthe grisea
GeneID:2712632 NCU03186.1 XP_330622.1 Neurospora crassa
GeneID:2892719 KLLA0D13838g XP_453679.1 Kluyveromyces lactis
GeneID:4340880 Os06g0318200 NP_001057501.1 Oryza sativa

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab1077 BPOZ antibody (ab1077); Goat polyclonal to BPOZ
2 abnova H00080325-M01 ABTB1 monoclonal antibody (M01), clone 3B3; Mouse monoclonal antibody raised against a partial recombinant ABTB1.
3 acris AP15926PU-N ABTB1 (C-term); antibody Ab

Exon, Intron and UTRs

Exon, Intron and UTRs of ABTB1 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of ABTB1 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0005515 Function protein binding
GO:0003746 Function translation elongation factor activity
GO:0006412 Process translation

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_032548  UCSC Browser NP_115937
2 NM_172027  UCSC Browser NP_742024
3 NM_172028  UCSC Browser NP_742025

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000232744 MI0000113 hsa-miR-106a AAAAGUGCUUACAGUGCAGGUAG
ENST00000232744 MI0000734 hsa-miR-106b UAAAGUGCUGACAGUGCAGAU
ENST00000232744 MI0000469 hsa-miR-125a-5p UCCCUGAGACCCUUUAACCUGUGA
ENST00000232744 MI0000446 hsa-miR-125b UCCCUGAGACCCUAACUUGUGA
ENST00000232744 MI0000470 hsa-miR-125b UCCCUGAGACCCUAACUUGUGA
ENST00000232744 MI0000252 hsa-miR-129* AAGCCCUUACCCCAAAAAGUAU
ENST00000232744 MI0000473 hsa-miR-129-3p AAGCCCUUACCCCAAAAAGCAU
ENST00000232744 MI0000454 hsa-miR-137 UUAUUGCUUAAGAAUACGCGUAG
ENST00000232744 MI0000071 hsa-miR-17 CAAAGUGCUUACAGUGCAGGUAG
ENST00000232744 MI0000269 hsa-miR-181a-2* ACCACUGACCGUUGACUGUACC
ENST00000232744 MI0000482 hsa-miR-185* AGGGGCUGGCUUUCCUCUGGUC
ENST00000232744 MI0000487 hsa-miR-193a-5p UGGGUCUUUGCGGGCGAGAUGA
ENST00000232744 MI0003137 hsa-miR-193b* CGGGGUUUUGAGGGCGAGAUGA
ENST00000232744 MI0000077 hsa-miR-21* CAACACCAGUCGAUGGGCUGU
ENST00000232744 MI0000286 hsa-miR-210 CUGUGCGUGUGACAGCGGCUGA
ENST00000232744 MI0000747 hsa-miR-296-5p AGGGCCCCCCCUCAAUCCUGU
ENST00000232744 MI0000087 hsa-miR-29a UAGCACCAUCUGAAAUCGGUUA
ENST00000232744 MI0000105 hsa-miR-29b UAGCACCAUUUGAAAUCAGUGUU
ENST00000232744 MI0000107 hsa-miR-29b UAGCACCAUUUGAAAUCAGUGUU
ENST00000232744 MI0000735 hsa-miR-29c UAGCACCAUUUGAAAUCGGUUA
ENST00000232744 MI0000813 hsa-miR-324-3p ACUGCCCCAGGUGCUGCUGG
ENST00000232744 MI0000813 hsa-miR-324-5p CGCAUCCCCUAGGGCAUUGGUGU
ENST00000232744 MI0000812 hsa-miR-331-3p GCCCCUGGGCCUAUCCUAGAA
ENST00000232744 MI0000091 hsa-miR-33a GUGCAUUGUAGUUGCAUUGCA
ENST00000232744 MI0003646 hsa-miR-33b GUGCAUUGCUGUUGCAUUGC
ENST00000232744 MI0000760 hsa-miR-361-3p UCCCCCAGGUGUGAUUCUGAUUU
ENST00000232744 MI0000780 hsa-miR-372 AAAGUGCUGCGACAUUUGAGCGU
ENST00000232744 MI0000785 hsa-miR-377 AUCACACAAAGGCAACUUUUGU
ENST00000232744 MI0003133 hsa-miR-432 UCUUGGAGUAGGUCAUUGGGUGG
ENST00000232744 MI0003133 hsa-miR-432* CUGGAUGGCUCCUCCAUGUCU
ENST00000232744 MI0002467 hsa-miR-483-3p UCACUCCUCUCCUCCCGUCUU
ENST00000232744 MI0002468 hsa-miR-484 UCAGGCUCAGUCCCCUCCCGAU
ENST00000232744 MI0002469 hsa-miR-485-3p GUCAUACACGGCUCUCCUCUCU
ENST00000232744 MI0003142 hsa-miR-498 UUUCAAGCCAGGGGGCGUUUUUC
ENST00000232744 MI0003144 hsa-miR-515-5p UUCUCCAAAAGAAAGCACUUUCUG
ENST00000232744 MI0003147 hsa-miR-515-5p UUCUCCAAAAGAAAGCACUUUCUG
ENST00000232744 MI0003167 hsa-miR-516b AUCUGGAGGUAAGAAGCACUUU
ENST00000232744 MI0003172 hsa-miR-516b AUCUGGAGGUAAGAAGCACUUU
ENST00000232744 MI0003170 hsa-miR-518a-3p GAAAGCGCUUCCCUUUGCUGGA
ENST00000232744 MI0003173 hsa-miR-518a-3p GAAAGCGCUUCCCUUUGCUGGA
ENST00000232744 MI0003156 hsa-miR-518b CAAAGCGCUCCCCUUUAGAGGU
ENST00000232744 MI0003145 hsa-miR-519e* UUCUCCAAAAGGGAGCACUUUC
ENST00000232744 MI0003163 hsa-miR-521 AACGCACUUCCCUUUAGAGUGU
ENST00000232744 MI0003176 hsa-miR-521 AACGCACUUCCCUUUAGAGUGU
ENST00000232744 MI0003205 hsa-miR-532-3p CCUCCCACACCCAAGGCUUGCA
ENST00000232744 MI0003564 hsa-miR-558 UGAGCUGCUGUACCAAAAU
ENST00000232744 MI0003608 hsa-miR-596 AAGCCUGCCCGGCUCCUCGGG
ENST00000232744 MI0003616 hsa-miR-603 CACACACUGCAAUUACUUUUGC
ENST00000232744 MI0003639 hsa-miR-625 AGGGGGAAAGUUCUAUAGUCC
ENST00000232744 MI0003663 hsa-miR-648 AAGUGUGCAGGGCACUGGU
ENST00000232744 MI0003672 hsa-miR-663 AGGCGGGGCGCCGCGGGACCGC
ENST00000232744 MI0003760 hsa-miR-671-5p AGGAAGCCCUGGAGGGGCUGGAG
ENST00000232744 MI0005559 hsa-miR-744* CUGUUGCCACUAACCUCAACCU
ENST00000232744 MI0003834 hsa-miR-769-3p CUGGGAUCUCCGGGGUCUUGGUU
ENST00000232744 MI0000095 hsa-miR-93* ACUGCUGAGCUAGCACUUCCCG
ENST00000232744 MI0005760 hsa-miR-938 UGCCCUUAAAGGUGAACCCAGU
ENST00000232744 MI0000389 mmu-miR-291a-3p AAAGUGCUUCCACUUUGUGUGC
ENST00000232744 MI0000389 mmu-miR-291a-5p CAUCAAAGUGGAGGCCCUCUCU
ENST00000232744 MI0003539 mmu-miR-291b-3p AAAGUGCAUCCAUUUUGUUUGU
ENST00000232744 MI0003539 mmu-miR-291b-5p GAUCAAAGUGGAGGCCCUCUCC
ENST00000232744 MI0000393 mmu-miR-295 AAAGUGCUACUACUUUUGAGUCU
ENST00000232744 MI0000590 mmu-miR-322 CAGCAGCAAUUCAUGUUUUGGA
ENST00000232744 MI0005494 mmu-miR-343 UCUCCCUUCAUGUGCCCAGA
ENST00000232744 MI0000640 mmu-miR-350 UUCACAAAGCCCAUACACUUUC
ENST00000232744 MI0000643 mmu-miR-351 UCCCUGAGGAGCCCUUUGAGCCUG
ENST00000232744 MI0005507 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENST00000232744 MI0005508 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENST00000232744 MI0005509 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENST00000232744 MI0005510 mmu-miR-466g AUACAGACACAUGCACACACA
ENST00000232744 MI0005511 mmu-miR-466h UGUGUGCAUGUGCUUGUGUGUA
ENST00000232744 MI0005512 mmu-miR-467c UAAGUGCGUGCAUGUAUAUGUG
ENST00000232744 MI0004295 mmu-miR-670 AUCCCUGAGUGUAUGUGGUGAA
ENST00000232744 MI0004686 mmu-miR-702 UGCCCACCCUUUACCCCGCUC
ENST00000232744 MI0004215 mmu-miR-762 GGGGCUGGGGCCGGGACAGAGC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
Ethinyl Estradiol
  • Ethinyl Estradiol affects the expression of ABTB1 mRNA
17555576
Tamoxifen
  • Tamoxifen affects the expression of ABTB1 mRNA
17555576

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Breast Neoplasms inferred via Tamoxifen 16202921, 17242785, 16818667, 17049068, 17893378, 15668708, 17440819, 17261762, 16873071, 11161223, 15565566
Carcinoma, Hepatocellular inferred via Tamoxifen 16924424
Carcinoma, Transitional Cell inferred via Tamoxifen 17572228
Endometrial Neoplasms inferred via Tamoxifen 16202921, 17893378
Fatty Liver inferred via Tamoxifen 14986274
Female Urogenital Diseases inferred via Tamoxifen 16709447
Lipidoses inferred via Tamoxifen 15342952
Liver Cirrhosis, Experimental inferred via Tamoxifen 18564211
Liver Neoplasms inferred via Tamoxifen 16684651
Mammary Neoplasms, Experimental inferred via Tamoxifen 11731420, 16827153, 14580682
Melanoma inferred via Tamoxifen 12393984
Melanoma, Amelanotic inferred via Tamoxifen 15990972
Spermatocele inferred via Tamoxifen 16709447
Urinary Bladder Neoplasms inferred via Tamoxifen 16712894, 17572228
Acne Vulgaris inferred via Ethinyl Estradiol 17505938
Adenocarcinoma inferred via Ethinyl Estradiol 14692618
Arteriosclerosis inferred via Ethinyl Estradiol 11256880
Arthritis, Experimental inferred via Ethinyl Estradiol 15885639
Cholestasis inferred via Ethinyl Estradiol 17110522, 17681005, 17333356, 16105132, 11677210, 15861022, 16919318
Encephalomyelitis, Autoimmune, Experimental inferred via Ethinyl Estradiol 12538720
Fatty Liver inferred via Ethinyl Estradiol 15345470
Hypospadias inferred via Ethinyl Estradiol 16569931, 16945680
Infertility, Female inferred via Ethinyl Estradiol 12013081
Infertility, Male inferred via Ethinyl Estradiol 17937319
Panic Disorder inferred via Ethinyl Estradiol 11578682
Pruritus inferred via Ethinyl Estradiol 16919318, 15861022
Spermatocele inferred via Ethinyl Estradiol 16709447
Thrombophilia inferred via Ethinyl Estradiol 11994571
Thrombosis inferred via Ethinyl Estradiol 15669648
Uterine Neoplasms inferred via Ethinyl Estradiol 14692618
Venous Thrombosis inferred via Ethinyl Estradiol 15869587

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Maezawa S, et al. (2008) "Bood POZ containing gene type 2 is a human counterpart of yeast Btb3p and promotes the degradation of terminal deoxynucleotidyltransferase." Genes Cells. 13(5):439-457. PMID:18429817
  2. [ + ] Koiwai K, et al. (2008) "BPOZ-2 directly binds to eEF1A1 to promote eEF1A1 ubiquitylation and degradation and prevent translation." Genes Cells. 13(6):593-607. PMID:18459963
  3. [ + ] Colland F, et al. (2004) "Functional proteomics mapping of a human signaling pathway." Genome Res. 14(7):1324-1332. PMID:15231748
  4. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  5. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  6. [ + ] Wan D, et al. (2004) "Large-scale cDNA transfection screening for genes related to cancer development and progression." Proc Natl Acad Sci U S A. 101(44):15724-15729. PMID:15498874
  7. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  8. [ + ] Unoki M, et al. (2001) "Growth-suppressive effects of BPOZ and EGR2, two genes involved in the PTEN signaling pathway." Oncogene. 20(33):4457-4465. PMID:11494141
  9. [ + ] Dai KS, et al. (2000) "Molecular cloning and characterization of a novel human gene containing ankyrin repeat and double BTB/POZ domain." Biochem Biophys Res Commun. 273(3):991-996. PMID:10891360