FN3KRP | GeneID:79672 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 79672 Official Symbol FN3KRP
Locus N/A Gene Type protein-coding
Synonyms FLJ12171; FN3KL
Full Name fructosamine 3 kinase related protein
Description fructosamine 3 kinase related protein
Chromosome 17q25.3
Also Known As fructosamine-3-kinase-related protein
Summary FN3KRP and FN3K (MIM 608425) protect proteins from nonenzymatic glycation by phosphorylating the modified amino acid. This phosphorylation destabilizes the sugar-amine linkage and leads to spontaneous decomposition (Conner et al., 2004 [PubMed 15381090]).[supplied by OMIM]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 11093

ID Symbol Protein Species
GeneID:79672 FN3KRP NP_078895.2 Homo sapiens
GeneID:191003 Y116A8C.25 NP_503025.1 Caenorhabditis elegans
GeneID:238024 BC032265 NP_852085.1 Mus musculus
GeneID:303755 Fn3krp XP_221214.4 Rattus norvegicus
GeneID:417336 FN3KRP XP_415602.2 Gallus gallus
GeneID:468364 LOC468364 XP_523753.2 Pan troglodytes
GeneID:480821 FN3KRP XP_537937.2 Canis lupus familiaris
GeneID:559954 MGC174333 NP_001103578.1 Danio rerio
GeneID:615868 FN3KRP NP_001069867.1 Bos taurus
GeneID:825280 AT3G61080 NP_191667.2 Arabidopsis thaliana
GeneID:4331411 Os03g0117800 NP_001048768.1 Oryza sativa

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab38285 Ketosamine-3-kinase antibody (ab38285); Rabbit polyclonal to Ketosamine-3-kinase
2 abgent AP7067b FN3X Antibody (C-term); Purified Rabbit Polyclonal Antibody (Pab)
3 abgent AP7067a FN3X Antibody (Center); Purified Rabbit Polyclonal Antibody (Pab)
4 acris AP13630PU-N FN3X (C-term); antibody Ab
5 acris AP13629PU-N FN3X (Center); antibody Ab
6 scbt FN3KRP FN3KRP Antibody / FN3KRP Antibodies;

Exon, Intron and UTRs

Exon, Intron and UTRs of FN3KRP Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of FN3KRP Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016301 Function kinase activity
GO:0016740 Function transferase activity

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_024619  UCSC Browser NP_078895

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000269373 MI0000458 hsa-miR-142-3p UGUAGUGUUUCCUACUUUAUGGA
ENST00000269373 MI0000458 hsa-miR-142-5p CAUAAAGUAGAAAGCACUACU
ENST00000269373 MI0000681 hsa-miR-155 UUAAUGCUAAUCGUGAUAGGGGU
ENST00000269373 MI0000465 hsa-miR-191 CAACGGAAUCCCAAAAGCAGCUG
ENST00000269373 MI0000284 hsa-miR-204 UUCCCUUUGUCAUCCUAUGCCU
ENST00000269373 MI0000294 hsa-miR-218-1* AUGGUUCCGUCAAGCACCAUGG
ENST00000269373 MI0005523 hsa-miR-298 AGCAGAAGCAGGGAGGUUCUCCCA
ENST00000269373 MI0000808 hsa-miR-326 CCUCUGGGCCCUUCCUCCAG
ENST00000269373 MI0003646 hsa-miR-33b GUGCAUUGCUGUUGCAUUGC
ENST00000269373 MI0001735 hsa-miR-409-3p GAAUGUUGCUCGGUGAACCCCU
ENST00000269373 MI0001721 hsa-miR-431 UGUCUUGCAGGCCGUCAUGCA
ENST00000269373 MI0001648 hsa-miR-449a UGGCAGUGUAUUGUUAGCUGGU
ENST00000269373 MI0003673 hsa-miR-449b AGGCAGUGUAUUGUUAGCUGGC
ENST00000269373 MI0002467 hsa-miR-483-5p AAGACGGGAGGAAAGAAGGGAG
ENST00000269373 MI0003186 hsa-miR-502-5p AUCCUUGCUAUCUGGGUGCUA
ENST00000269373 MI0003180 hsa-miR-516a-3p UGCUUCCUUUCAGAGGGU
ENST00000269373 MI0003181 hsa-miR-516a-3p UGCUUCCUUUCAGAGGGU
ENST00000269373 MI0003170 hsa-miR-518a-5p CUGCAAAGGGAAGCCCUUUC
ENST00000269373 MI0003173 hsa-miR-518a-5p CUGCAAAGGGAAGCCCUUUC
ENST00000269373 MI0005539 hsa-miR-541* AAAGGAUUCUGCUGUCGGUCCCACU
ENST00000269373 MI0003679 hsa-miR-549 UGACAACUAUGGAUGAGCUCU
ENST00000269373 MI0003589 hsa-miR-582-5p UUACAGUUGUUCAACCAGUUACU
ENST00000269373 MI0003608 hsa-miR-596 AAGCCUGCCCGGCUCCUCGGG
ENST00000269373 MI0003624 hsa-miR-611 GCGAGGACCCCUCGGGGUCUGAC
ENST00000269373 MI0003653 hsa-miR-638 AGGGAUCGCGGGCGGGUGGCGGCCU
ENST00000269373 MI0003657 hsa-miR-642 GUCCCUCUCCAAAUGUGUCUUG
ENST00000269373 MI0003659 hsa-miR-644 AGUGUGGCUUUCUUAGAGC
ENST00000269373 MI0003683 hsa-miR-659 CUUGGUUCAGGGAGGGUCCCCA
ENST00000269373 MI0003763 hsa-miR-767-3p UCUGCUCAUACCCCAUGGUUUCU
ENST00000269373 MI0003834 hsa-miR-769-5p UGAGACCUCUGGGUUCUGAGCU
ENST00000269373 MI0005561 hsa-miR-877 GUAGAGGAGAUGGCGCAGGG
ENST00000269373 MI0005713 hsa-miR-921 CUAGUGAGGGACAGAACCAGGAUUC
ENST00000269373 MI0005755 hsa-miR-933 UGUGCGCAGGGAGACCUCUCCC
ENST00000269373 MI0004638 mmu-miR-679 GGACUGUGAGGUGACUCUUGGU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Payne LS, et al. (2008) "Mapping of the ATP-binding domain of human fructosamine 3-kinase-related protein by affinity labelling with 5'-[p-(fluorosulfonyl)benzoyl]adenosine." Biochem J. 416(2):281-288. PMID:18637789
  2. [ + ] Szwergold BS, et al. (2007) "Fructosamine-6-phosphates are deglycated by phosphorylation to fructosamine-3,6-bisphosphates catalyzed by fructosamine-3-kinase (FN3K) and/or fructosamine-3-kinase-related-protein (FN3KRP)." Med Hypotheses. 68(1):37-45. PMID:16920277
  3. [ + ] Szwergold B, et al. (2007) "Fructosamine-3-kinase-related-protein phosphorylates glucitolamines on the C-4 hydroxyl: novel substrate specificity of an enigmatic enzyme." Biochem Biophys Res Commun. 361(4):870-875. PMID:17686456
  4. [ + ] Kimura K, et al. (2006) "Diversification of transcriptional modulation: large-scale identification and characterization of putative alternative promoters of human genes." Genome Res. 16(1):55-65. PMID:16344560
  5. [ + ] Conner JR, et al. (2005) "Some clues as to the regulation, expression, function, and distribution of fructosamine-3-kinase and fructosamine-3-kinase-related protein." Ann N Y Acad Sci. 1043():824-836. PMID:16037310
  6. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  7. [ + ] Ota T, et al. (2004) "Complete sequencing and characterization of 21,243 full-length human cDNAs." Nat Genet. 36(1):40-45. PMID:14702039
  8. [ + ] Collard F, et al. (2004) "Fructosamine 3-kinase-related protein and deglycation in human erythrocytes." Biochem J. 382(Pt 1):137-143. PMID:15137908
  9. [ + ] Conner JR, et al. (2004) "The expression of the genes for fructosamine-3-kinase and fructosamine-3-kinase-related protein appears to be constitutive and unaffected by environmental signals." Biochem Biophys Res Commun. 323(3):932-936. PMID:15381090
  10. [ + ] Collard F, et al. (2003) "A mammalian protein homologous to fructosamine-3-kinase is a ketosamine-3-kinase acting on psicosamines and ribulosamines but not on fructosamines." Diabetes. 52(12):2888-2895. PMID:14633848
  11. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  12. [ + ] Wiemann S, et al. (2001) "Toward a catalog of human genes and proteins: sequencing and analysis of 500 novel complete protein coding human cDNAs." Genome Res. 11(3):422-435. PMID:11230166