Abi1 | GeneID:79249 | Rattus norvegicus
Gene Summary
[
] NCBI Entrez Gene
| Gene ID | 79249 | Official Symbol | Abi1 |
|---|---|---|---|
| Locus | N/A | Gene Type | protein-coding |
| Synonyms | E3b1 | ||
| Full Name | abl-interactor 1 | ||
| Description | abl-interactor 1 | ||
| Chromosome | 17q12.3 | ||
| Also Known As | eps8 binding protein (e3B1), alternatively spliced | ||
| Summary | N/A | ||
Orthologs and Paralogs
[
] Homologs - NCBI's HomoloGene Group: 38053
| ID | Symbol | Protein | Species |
|---|---|---|---|
| GeneID:10006 | ABI1 | NP_005461.2 | Homo sapiens |
| GeneID:11308 | Abi1 | NP_001070658.1 | Mus musculus |
| GeneID:79249 | Abi1 | NP_077373.1 | Rattus norvegicus |
| GeneID:420489 | RCJMB04_25c5 | XP_001233769.1 | Gallus gallus |
| GeneID:450363 | ABI1 | XP_001159512.1 | Pan troglodytes |
| GeneID:607247 | ABI1 | XP_849209.1 | Canis lupus familiaris |
| GeneID:767738 | zgc:153534 | NP_001070175.1 | Danio rerio |
Antibodies
[
] Monoclonal and Polyclonal Antibodies
| No. | Provider | Product No. | Description |
|---|---|---|---|
| 1 | abcam | ab11222 | SSH3BP1 antibody [4E2] (ab11222); Mouse monoclonal [4E2] to SSH3BP1 |
| 2 | abcam | ab65828 | SSH3BP1 antibody - Carboxyterminal end (ab65828); Rabbit polyclonal to SSH3BP1 - Carboxyterminal end |
| 3 | abcam | ab62660 | SSH3BP1 antibody (ab62660); Rabbit polyclonal to SSH3BP1 |
| 4 | sigma | A5106 | Anti-ABI1 antibody produced in rabbit ; |
| 5 | sigma | A5231 | Anti-Abi1 (C-terminal) antibody produced in rabbit ; |
Gene Classification
[
] Gene Ontology
| ID | Category | GO Term |
|---|---|---|
| GO:0030054 | Component | cell junction |
| GO:0005737 | Component | cytoplasm |
| GO:0005856 | Component | cytoskeleton |
| GO:0030175 | Component | filopodium |
| GO:0030426 | Component | growth cone |
| GO:0030027 | Component | lamellipodium |
| GO:0005634 | Component | nucleus |
| GO:0045202 | Component | synapse |
| GO:0019717 | Component | synaptosome |
MicroRNA and Targets
[
] MicroRNA Sequences and Transcript Targets from miRBase at Sanger
| RNA Target | miRNA # | mat miRNA | Mature miRNA Sequence |
|---|---|---|---|
| ENSRNOT00000057573 | MI0000779 | hsa-miR-371-5p | ACUCAAACUGUGGGGGCACU |
| ENSRNOT00000057573 | MI0003195 | hsa-miR-508-3p | UGAUUGUAGCCUUUUGGAGUAGA |
| ENSRNOT00000057573 | MI0003140 | hsa-miR-512-3p | AAGUGCUGUCAUAGCUGAGGUC |
| ENSRNOT00000057573 | MI0003141 | hsa-miR-512-3p | AAGUGCUGUCAUAGCUGAGGUC |
| ENSRNOT00000057573 | MI0003596 | hsa-miR-548b-3p | CAAGAACCUCAGUUGCUUUUGU |
| ENSRNOT00000057573 | MI0003679 | hsa-miR-549 | UGACAACUAUGGAUGAGCUCU |
| ENSRNOT00000057573 | MI0003597 | hsa-miR-588 | UUGGCCACAAUGGGUUAGAAC |
| ENSRNOT00000057573 | MI0003635 | hsa-miR-621 | GGCUAGCAACAGCGCUUACCU |
| ENSRNOT00000057573 | MI0003651 | hsa-miR-636 | UGUGCUUGCUCGUCCCGCCCGCA |
| ENSRNOT00000057573 | MI0000177 | mmu-miR-155 | UUAAUGCUAAUUGUGAUAGGGGU |
| ENSRNOT00000057573 | MI0003531 | mmu-miR-367 | AAUUGCACUUUAGCAAUGGUGA |
| ENSRNOT00000057573 | MI0002403 | mmu-miR-468 | UAUGACUGAUGUGCGUGUGUCUG |
| ENSRNOT00000057573 | MI0004695 | mmu-miR-711 | GGGACCCGGGGAGAGAUGUAAG |
| ENSRNOT00000057573 | MI0004651 | mmu-miR-719 | AUCUCGGCUACAGAAAAAUGUU |
| ENSRNOT00000057573 | MI0004310 | mmu-miR-764-5p | GGUGCUCACAUGUCCUCCU |
| ENSRNOT00000057573 | MI0000835 | rno-let-7i* | CUGCGCAAGCUACUGCCUUGCU |
| ENSRNOT00000057573 | MI0000953 | rno-miR-181a* | ACCAUCGACCGUUGAUUGUACC |
| ENSRNOT00000057573 | MI0000964 | rno-miR-290 | CUCAAACUAUGGGGGCACUUUUU |
| ENSRNOT00000057573 | MI0000966 | rno-miR-292-3p | AAGUGCCGCCAGGUUUUGAGUGU |
| ENSRNOT00000057573 | MI0000966 | rno-miR-292-5p | ACUCAAACUGGGGGCUCUUUUG |
| ENSRNOT00000057573 | MI0000968 | rno-miR-297 | AUGUAUGUGUGCAUGUAUGCAUG |
| ENSRNOT00000057573 | MI0000873 | rno-miR-32 | UAUUGCACAUUACUAAGUUGCA |
| ENSRNOT00000057573 | MI0003550 | rno-miR-409-3p | AAUGUUGCUCGGUGAACCCC |
| ENSRNOT00000057573 | MI0006147 | rno-miR-434 | UUUGAACCAUCACUCGACUCCU |
| ENSRNOT00000057573 | MI0006112 | rno-miR-466b | UAUGUGUGUGUGUAUGUCCAUG |
| ENSRNOT00000057573 | MI0006113 | rno-miR-466b | UAUGUGUGUGUGUAUGUCCAUG |
| ENSRNOT00000057573 | MI0003547 | rno-miR-487b | AAUCGUACAGGGUCAUCCACU |
| ENSRNOT00000057573 | MI0003542 | rno-miR-494 | UGAAACAUACACGGGAAACCU |
| ENSRNOT00000057573 | MI0006122 | rno-miR-880 | UACUCCAUUCAUUCUGAGUAGA |
Selected Publications
[
] Gene-related publications indexed at PubMed
- [
] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932 - [
] Courtney KD, et al. (2000) "Localization and phosphorylation of Abl-interactor proteins, Abi-1 and Abi-2, in the developing nervous system." Mol Cell Neurosci. 16(3):244-257. PMID:10995551 - [
] Ziemnicka-Kotula D, et al. (1998) "Identification of a candidate human spectrin Src homology 3 domain-binding protein suggests a general mechanism of association of tyrosine kinases with the spectrin-based membrane skeleton." J Biol Chem. 273(22):13681-13692. PMID:9593709
The National Institutes of Health Mammalian Gene Collection (MGC) Program is a multiinstitutional effort to identify and sequence a cDNA clone containing a complete ORF for each human and mouse gene. ESTs were generated from libraries enriched for full-length cDNAs and analyzed to identify candidate full-ORF clones, which then were sequenced to high accuracy. The MGC has currently sequenced and verified the full ORF for a nonredundant set of >9,000 human and >6,000 mouse genes. Candidate full-ORF clones for an additional 7,800 human and 3,500 mouse genes also have been identified. All MGC sequences and clones are available without restriction through public databases and clone distribution networks (see http:mgc.nci.nih.gov).
Abl-interactor (Abi) proteins are targets of Abl-family nonreceptor tyrosine kinases and are required for Rac-dependent cytoskeletal reorganization in response to growth factor stimulation. We asked if the expression, phosphorylation, and cellular localization of Abi-1 and Abi-2 supports a role for these proteins in Abl signaling in the developing and adult mouse nervous system. In mid- to late-gestation embryos, abi-2 message is elevated in the central and peripheral nervous systems (CNS and PNS). Abi-1 mRNA is present, but not enhanced, in the CNS, and is not observed in PNS structures. Abi proteins from brain lysates undergo changes in apparent molecular weight and phosphorylation with increasing age. In the postnatal brain, abi-1 and abi-2 are expressed most prominently in cortical layers populated by projection neurons. In cultured neurons, Abi-1 and Abi-2 are concentrated in puncta throughout the cell body and processes. Both Abi and Abl proteins are present in synaptosomes and growth cone particles. Therefore, the Abi adaptors exhibit proper expression patterns and subcellular localization to participate in Abl kinase signaling in the nervous system.
Spectrin is a widely expressed protein with specific isoforms found in erythroid and nonerythroid cells. Spectrin contains an Src homology 3 (SH3) domain of unknown function. A cDNA encoding a candidate spectrin SH3 domain-binding protein was identified by interaction screening of a human brain expression library using the human erythroid spectrin (alphaI) SH3 domain as a bait. Five isoforms of the alphaI SH3 domain-binding protein mRNA were identified in human brain. Mapping of SH3 binding regions revealed the presence of two alphaI SH3 domain binding regions and one Abl-SH3 domain binding region. The gene encoding the candidate spectrin SH3 domain-binding protein has been located to human chromosome 10p11.2 --> p12. The gene belongs to a recently identified family of tyrosine kinase-binding proteins, and one of its isoforms is identical to e3B1, an eps8-binding protein (Biesova, Z., Piccoli, C., and Wong, W. T. (1997)Oncogene 14, 233-241). Overexpression of the green fluorescent protein fusion of the SH3 domain-binding protein in NIH3T3 cells resulted in cytoplasmic punctate fluorescence characteristic of the reticulovesicular system. This fluorescence pattern was similar to that obtained with the anti-human erythroid spectrin alphaI SigmaI/betaI SigmaI antibody in untransfected NIH3T3 cells; in addition, the anti-alphaI SigmaI/betaI SigmaI antibody also stained Golgi apparatus. Immunofluorescence obtained using antibodies against alphaI SigmaI/++betaI SigmaI spectrin and Abl tyrosine kinase but not against alphaII/betaII spectrin colocalized with the overexpressed green fluorescent protein-SH3-binding protein. Based on the conservation of the spectrin SH3 binding site within members of this protein family and published interactions, a general mechanism of interactions of tyrosine kinases with the spectrin-based membrane skeleton is proposed.