Abi1 | GeneID:79249 | Rattus norvegicus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 79249 Official Symbol Abi1
Locus N/A Gene Type protein-coding
Synonyms E3b1
Full Name abl-interactor 1
Description abl-interactor 1
Chromosome 17q12.3
Also Known As eps8 binding protein (e3B1), alternatively spliced
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 38053

ID Symbol Protein Species
GeneID:10006 ABI1 NP_005461.2 Homo sapiens
GeneID:11308 Abi1 NP_001070658.1 Mus musculus
GeneID:79249 Abi1 NP_077373.1 Rattus norvegicus
GeneID:420489 RCJMB04_25c5 XP_001233769.1 Gallus gallus
GeneID:450363 ABI1 XP_001159512.1 Pan troglodytes
GeneID:607247 ABI1 XP_849209.1 Canis lupus familiaris
GeneID:767738 zgc:153534 NP_001070175.1 Danio rerio

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab11222 SSH3BP1 antibody [4E2] (ab11222); Mouse monoclonal [4E2] to SSH3BP1
2 abcam ab65828 SSH3BP1 antibody - Carboxyterminal end (ab65828); Rabbit polyclonal to SSH3BP1 - Carboxyterminal end
3 abcam ab62660 SSH3BP1 antibody (ab62660); Rabbit polyclonal to SSH3BP1
4 sigma A5106 Anti-ABI1 antibody produced in rabbit ;
5 sigma A5231 Anti-Abi1 (C-terminal) antibody produced in rabbit ;

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0030054 Component cell junction
GO:0005737 Component cytoplasm
GO:0005856 Component cytoskeleton
GO:0030175 Component filopodium
GO:0030426 Component growth cone
GO:0030027 Component lamellipodium
GO:0005634 Component nucleus
GO:0045202 Component synapse
GO:0019717 Component synaptosome

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_024397  UCSC Browser NP_077373

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSRNOT00000057573 MI0000779 hsa-miR-371-5p ACUCAAACUGUGGGGGCACU
ENSRNOT00000057573 MI0003195 hsa-miR-508-3p UGAUUGUAGCCUUUUGGAGUAGA
ENSRNOT00000057573 MI0003140 hsa-miR-512-3p AAGUGCUGUCAUAGCUGAGGUC
ENSRNOT00000057573 MI0003141 hsa-miR-512-3p AAGUGCUGUCAUAGCUGAGGUC
ENSRNOT00000057573 MI0003596 hsa-miR-548b-3p CAAGAACCUCAGUUGCUUUUGU
ENSRNOT00000057573 MI0003679 hsa-miR-549 UGACAACUAUGGAUGAGCUCU
ENSRNOT00000057573 MI0003597 hsa-miR-588 UUGGCCACAAUGGGUUAGAAC
ENSRNOT00000057573 MI0003635 hsa-miR-621 GGCUAGCAACAGCGCUUACCU
ENSRNOT00000057573 MI0003651 hsa-miR-636 UGUGCUUGCUCGUCCCGCCCGCA
ENSRNOT00000057573 MI0000177 mmu-miR-155 UUAAUGCUAAUUGUGAUAGGGGU
ENSRNOT00000057573 MI0003531 mmu-miR-367 AAUUGCACUUUAGCAAUGGUGA
ENSRNOT00000057573 MI0002403 mmu-miR-468 UAUGACUGAUGUGCGUGUGUCUG
ENSRNOT00000057573 MI0004695 mmu-miR-711 GGGACCCGGGGAGAGAUGUAAG
ENSRNOT00000057573 MI0004651 mmu-miR-719 AUCUCGGCUACAGAAAAAUGUU
ENSRNOT00000057573 MI0004310 mmu-miR-764-5p GGUGCUCACAUGUCCUCCU
ENSRNOT00000057573 MI0000835 rno-let-7i* CUGCGCAAGCUACUGCCUUGCU
ENSRNOT00000057573 MI0000953 rno-miR-181a* ACCAUCGACCGUUGAUUGUACC
ENSRNOT00000057573 MI0000964 rno-miR-290 CUCAAACUAUGGGGGCACUUUUU
ENSRNOT00000057573 MI0000966 rno-miR-292-3p AAGUGCCGCCAGGUUUUGAGUGU
ENSRNOT00000057573 MI0000966 rno-miR-292-5p ACUCAAACUGGGGGCUCUUUUG
ENSRNOT00000057573 MI0000968 rno-miR-297 AUGUAUGUGUGCAUGUAUGCAUG
ENSRNOT00000057573 MI0000873 rno-miR-32 UAUUGCACAUUACUAAGUUGCA
ENSRNOT00000057573 MI0003550 rno-miR-409-3p AAUGUUGCUCGGUGAACCCC
ENSRNOT00000057573 MI0006147 rno-miR-434 UUUGAACCAUCACUCGACUCCU
ENSRNOT00000057573 MI0006112 rno-miR-466b UAUGUGUGUGUGUAUGUCCAUG
ENSRNOT00000057573 MI0006113 rno-miR-466b UAUGUGUGUGUGUAUGUCCAUG
ENSRNOT00000057573 MI0003547 rno-miR-487b AAUCGUACAGGGUCAUCCACU
ENSRNOT00000057573 MI0003542 rno-miR-494 UGAAACAUACACGGGAAACCU
ENSRNOT00000057573 MI0006122 rno-miR-880 UACUCCAUUCAUUCUGAGUAGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  2. [ + ] Courtney KD, et al. (2000) "Localization and phosphorylation of Abl-interactor proteins, Abi-1 and Abi-2, in the developing nervous system." Mol Cell Neurosci. 16(3):244-257. PMID:10995551
  3. [ + ] Ziemnicka-Kotula D, et al. (1998) "Identification of a candidate human spectrin Src homology 3 domain-binding protein suggests a general mechanism of association of tyrosine kinases with the spectrin-based membrane skeleton." J Biol Chem. 273(22):13681-13692. PMID:9593709