Abca2 | GeneID:79248 | Rattus norvegicus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 79248 Official Symbol Abca2
Locus N/A Gene Type protein-coding
Synonyms Abc2
Full Name ATP-binding cassette, sub-family A (ABC1), member 2
Description ATP-binding cassette, sub-family A (ABC1), member 2
Chromosome 3p13
Also Known As
Summary glycosylated ABC transporter that binds ATP in the presence of magnesium; may play an important role in brain function [RGD]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 55590

ID Symbol Protein Species
GeneID:20 ABCA2 NP_001597.2 Homo sapiens
GeneID:11305 Abca2 NP_031405.2 Mus musculus
GeneID:79248 Abca2 NP_077372.1 Rattus norvegicus
GeneID:480669 ABCA2 XP_537788.2 Canis lupus familiaris

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016023 Component cytoplasmic membrane-bounded vesicle
GO:0016021 Component integral to membrane
GO:0005765 Component lysosomal membrane
GO:0016020 Component membrane
GO:0005815 Component microtubule organizing center
GO:0016887 Function ATPase activity
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding
GO:0042632 Process cholesterol homeostasis
GO:0032383 Process regulation of intracellular cholesterol transport
GO:0006357 Process regulation of transcription from RNA polymerase II promoter
GO:0048545 Process response to steroid hormone stimulus
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_024396  UCSC Browser NP_077372

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSRNOT00000020339 MI0003625 hsa-miR-612 GCUGGGCAGGGCUUCUGAGCUCCUU
ENSRNOT00000020339 MI0003638 hsa-miR-624 CACAAGGUAUUGGUAUUACCU
ENSRNOT00000020339 MI0003670 hsa-miR-662 UCCCACGUUGUGGCCCAGCAG
ENSRNOT00000020339 MI0005767 hsa-miR-942 UCUUCUCUGUUUUGGCCAUGUG
ENSRNOT00000020339 MI0004295 mmu-miR-670 AUCCCUGAGUGUAUGUGGUGAA
ENSRNOT00000020339 MI0004662 mmu-miR-693-5p CAGCCACAUCCGAAAGUUUUC
ENSRNOT00000020339 MI0004707 mmu-miR-718 CUUCCGCCCGGCCGGGUGUCG
ENSRNOT00000020339 MI0004215 mmu-miR-762 GGGGCUGGGGCCGGGACAGAGC
ENSRNOT00000020339 MI0000829 rno-let-7b* CUAUACAACCUACUGCCUUCCC
ENSRNOT00000020339 MI0000830 rno-let-7c UGAGGUAGUAGGUUGUAUGGUU
ENSRNOT00000020339 MI0000831 rno-let-7c UGAGGUAGUAGGUUGUAUGGUU
ENSRNOT00000020339 MI0000601 rno-let-7d* CUAUACGACCUGCUGCCUUUCU
ENSRNOT00000020339 MI0000832 rno-let-7e* CUAUACGGCCUCCUAGCUUUCC
ENSRNOT00000020339 MI0000835 rno-let-7i* CUGCGCAAGCUACUGCCUUGCU
ENSRNOT00000020339 MI0000906 rno-miR-133a UUUGGUCCCCUUCAACCAGCUG
ENSRNOT00000020339 MI0003490 rno-miR-133b UUUGGUCCCCUUCAACCAGCUA
ENSRNOT00000020339 MI0000645 rno-miR-135b UAUGGCUUUUCAUUCCUAUGUGA
ENSRNOT00000020339 MI0000647 rno-miR-151* CUAGACUGAGGCUCCUUGAGG
ENSRNOT00000020339 MI0000925 rno-miR-181a AACAUUCAACGCUGUCGGUGAGU
ENSRNOT00000020339 MI0000953 rno-miR-181a AACAUUCAACGCUGUCGGUGAGU
ENSRNOT00000020339 MI0000926 rno-miR-181b AACAUUCAUUGCUGUCGGUGGGU
ENSRNOT00000020339 MI0000927 rno-miR-181b AACAUUCAUUGCUGUCGGUGGGU
ENSRNOT00000020339 MI0006132 rno-miR-181d AACAUUCAUUGUUGUCGGUGGGU
ENSRNOT00000020339 MI0000851 rno-miR-22 AAGCUGCCAGUUGAAGAACUGU
ENSRNOT00000020339 MI0000862 rno-miR-29b-2* CUGGUUUCACAUGGUGGCUUAG
ENSRNOT00000020339 MI0000971 rno-miR-300-3p UAUGCAAGGGCAAGCUCUCUUC
ENSRNOT00000020339 MI0000872 rno-miR-31 AGGCAAGAUGCUGGCAUAGCUG
ENSRNOT00000020339 MI0000972 rno-miR-320 AAAAGCUGGGUUGAGAGGGCGA
ENSRNOT00000020339 MI0000594 rno-miR-324-5p CGCAUCCCCUAGGGCAUUGGUGU
ENSRNOT00000020339 MI0000600 rno-miR-327 CCUUGAGGGGCAUGAGGGU
ENSRNOT00000020339 MI0003541 rno-miR-379 UGGUAGACUAUGGAACGUAGG
ENSRNOT00000020339 MI0003546 rno-miR-381 UAUACAAGGGCAAGCUCUC
ENSRNOT00000020339 MI0003488 rno-miR-412 ACUUCACCUGGUCCACUAGCCGU
ENSRNOT00000020339 MI0006152 rno-miR-495 AAACAAACAUGGUGCACUUCUU
ENSRNOT00000020339 MI0000838 rno-miR-9 UCUUUGGUUAUCUAGCUGUAUGA
ENSRNOT00000020339 MI0000839 rno-miR-9 UCUUUGGUUAUCUAGCUGUAUGA
ENSRNOT00000020339 MI0000840 rno-miR-9 UCUUUGGUUAUCUAGCUGUAUGA
ENSRNOT00000020339 MI0000881 rno-miR-96 UUUGGCACUAGCACAUUUUUGCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Broccardo C, et al. (2006) "ABCA2 is a marker of neural progenitors and neuronal subsets in the adult rodent brain." J Neurochem. 97(2):345-355. PMID:16539677
  2. [ + ] Tanaka Y, et al. (2003) "Temporal and spatial profiles of ABCA2-expressing oligodendrocytes in the developing rat brain." J Comp Neurol. 455(3):353-367. PMID:12483687
  3. [ + ] Zhou CJ, et al. (2002) "ATP-binding cassette transporter ABCA2 (ABC2) expression in the developing spinal cord and PNS during myelination." J Comp Neurol. 451(4):334-345. PMID:12210128
  4. [ + ] Zhao LX, et al. (2000) "Cloning, characterization and tissue distribution of the rat ATP-binding cassette (ABC) transporter ABC2/ABCA2." Biochem J. 350 Pt 3():865-872. PMID:10970803