accn2b | GeneID:791696 | Danio rerio

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 791696 Official Symbol accn2b
Locus CH211-255G12.1 Gene Type protein-coding
Synonyms MGC193950; zASIC1.2
Full Name amiloride-sensitive cation channel 2 b
Description amiloride-sensitive cation channel 2 b
Chromosome N/A
Also Known As acid-sensing ion channel 1.2
Summary N/A

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0005887 Component integral to plasma membrane
GO:0016020 Component membrane
GO:0005886 Component plasma membrane
GO:0015280 Function amiloride-sensitive sodium channel activity
GO:0005261 Function cation channel activity
GO:0005216 Function ion channel activity
GO:0005272 Function sodium channel activity
GO:0031402 Function sodium ion binding
GO:0006811 Process ion transport
GO:0006814 Process sodium ion transport
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_214790 NP_999955 B0R1B0   Q708S7  
2 XM_001331737 XP_001331773 B0R1B0   Q708S7  

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSDART00000004588 MI0002002 dre-miR-138 AGCUGGUGUUGUGAAUCAGGCC
ENSDART00000004588 MI0002004 dre-miR-141 UAACACUGUCUGGUAACGAUGC
ENSDART00000004588 MI0002037 dre-miR-200a UAACACUGUCUGGUAACGAUGU
ENSDART00000004588 MI0002038 dre-miR-200b UAAUACUGCCUGGUAAUGAUGA
ENSDART00000004588 MI0002039 dre-miR-200c UAAUACUGCCUGGUAAUGAUGC
ENSDART00000004588 MI0001383 dre-miR-217 UACUGCAUCAGGAACUGAUUGG
ENSDART00000004588 MI0002050 dre-miR-217 UACUGCAUCAGGAACUGAUUGG
ENSDART00000004588 MI0001386 dre-miR-220 CCACAACCGUAUCGGACACUU
ENSDART00000004588 MI0001720 dre-miR-429 UAAUACUGUCUGGUAAUGCCGU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Paukert M, et al. (2004) "A family of acid-sensing ion channels from the zebrafish: widespread expression in the central nervous system suggests a conserved role in neuronal communication." J Biol Chem. 279(18):18783-18791. PMID:14970195
  2. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932