Accn2 | GeneID:79123 | Rattus norvegicus
Gene Summary
[
] NCBI Entrez Gene
| Gene ID | 79123 | Official Symbol | Accn2 |
|---|---|---|---|
| Locus | N/A | Gene Type | protein-coding |
| Synonyms | Asic1 | ||
| Full Name | amiloride-sensitive cation channel 2, neuronal | ||
| Description | amiloride-sensitive cation channel 2, neuronal | ||
| Chromosome | 7q36 | ||
| Also Known As | proton gated cation channel ASIC1 | ||
| Summary | forms a proton-gated ion channel that may play a role in sensory neuron function and pain perception [RGD] | ||
Orthologs and Paralogs
[
] Homologs - NCBI's HomoloGene Group: 37440
| ID | Symbol | Protein | Species |
|---|---|---|---|
| GeneID:41 | ACCN2 | NP_001086.2 | Homo sapiens |
| GeneID:11419 | Accn2 | NP_033727.1 | Mus musculus |
| GeneID:79123 | Accn2 | NP_077068.1 | Rattus norvegicus |
| GeneID:171992 | C24G7.4 | NP_491293.1 | Caenorhabditis elegans |
| GeneID:181468 | flr-1 | NP_510243.1 | Caenorhabditis elegans |
| GeneID:182851 | C24G7.1 | NP_491296.1 | Caenorhabditis elegans |
| GeneID:182852 | C24G7.2 | NP_491295.2 | Caenorhabditis elegans |
| GeneID:182963 | tag-324 | NP_510463.2 | Caenorhabditis elegans |
| GeneID:184882 | F23B2.3 | NP_501590.2 | Caenorhabditis elegans |
| GeneID:185036 | F28A12.1 | NP_505230.1 | Caenorhabditis elegans |
| GeneID:189051 | T28F2.7 | NP_491196.2 | Caenorhabditis elegans |
| GeneID:407670 | accn2c | NP_999954.1 | Danio rerio |
| GeneID:426883 | ACCN2 | NP_001035557.1 | Gallus gallus |
| GeneID:451888 | ACCN2 | XP_001155207.1 | Pan troglodytes |
Gene Classification
[
] Gene Ontology
| ID | Category | GO Term |
|---|---|---|
| GO:0005887 | Component | integral to plasma membrane |
| GO:0019717 | Component | synaptosome |
| GO:0005261 | Function | cation channel activity |
| GO:0005216 | Function | ion channel activity |
| GO:0005515 | Function | protein binding |
| GO:0008306 | Process | associative learning |
| GO:0006812 | Process | cation transport |
| GO:0007613 | Process | memory |
| GO:0001101 | Process | response to acid |
| GO:0019233 | Process | sensory perception of pain |
MicroRNA and Targets
[
] MicroRNA Sequences and Transcript Targets from miRBase at Sanger
| RNA Target | miRNA # | mat miRNA | Mature miRNA Sequence |
|---|---|---|---|
| ENSRNOT00000025476 | MI0005560 | hsa-miR-885-3p | AGGCAGCGGGGUGUAGUGGAUA |
| ENSRNOT00000025476 | MI0005763 | hsa-miR-941 | CACCCGGCUGUGUGCACAUGUGC |
| ENSRNOT00000025476 | MI0005764 | hsa-miR-941 | CACCCGGCUGUGUGCACAUGUGC |
| ENSRNOT00000025476 | MI0005765 | hsa-miR-941 | CACCCGGCUGUGUGCACAUGUGC |
| ENSRNOT00000025476 | MI0005766 | hsa-miR-941 | CACCCGGCUGUGUGCACAUGUGC |
| ENSRNOT00000025476 | MI0000865 | rno-miR-29c* | UGACCGAUUUCUCCUGGUGUUC |
| ENSRNOT00000025476 | MI0000622 | rno-miR-340-3p | UCCGUCUCAGUUACUUUAUAGCC |
Selected Publications
[
] Gene-related publications indexed at PubMed
- [
] Grifoni SC, et al. (2008) "ASIC proteins regulate smooth muscle cell migration." Microvasc Res. 75(2):202-210. PMID:17936312 - [
] Herrera Y, et al. (2008) "sigma-1 receptor modulation of acid-sensing ion channel a (ASIC1a) and ASIC1a-induced Ca2+ influx in rat cortical neurons." J Pharmacol Exp Ther. 327(2):491-502. PMID:18723775 - [
] Omori M, et al. (2008) "Effects of selective spinal nerve ligation on acetic acid-induced nociceptive responses and ASIC3 immunoreactivity in the rat dorsal root ganglion." Brain Res. 1219():26-31. PMID:18534561 - [
] Feldman DH, et al. (2008) "Characterization of acid-sensing ion channel expression in oligodendrocyte-lineage cells." Glia. 56(11):1238-1249. PMID:18452213 - [
] Dorofeeva NA, et al. (2008) "Mechanisms of non-steroid anti-inflammatory drugs action on ASICs expressed in hippocampal interneurons." J Neurochem. 106(1):429-441. PMID:18410516 - [
] Tan ZY, et al. (2007) "Acid-sensing ion channels contribute to transduction of extracellular acidosis in rat carotid body glomus cells." Circ Res. 101(10):1009-1019. PMID:17872465 - [
] Chai S, et al. (2007) "A kinase-anchoring protein 150 and calcineurin are involved in regulation of acid-sensing ion channels ASIC1a and ASIC2a." J Biol Chem. 282(31):22668-22677. PMID:17548344 - [
] Chen X, et al. (2007) "Permeating protons contribute to tachyphylaxis of the acid-sensing ion channel (ASIC) 1a." J Physiol. 579(Pt 3):657-670. PMID:17204502 - [
] Kawamata T, et al. (2006) "Immunohistochemical analysis of acid-sensing ion channel 2 expression in rat dorsal root ganglion and effects of axotomy." Neuroscience. 143(1):175-187. PMID:16949762 - [
] Ettaiche M, et al. (2006) "Silencing acid-sensing ion channel 1a alters cone-mediated retinal function." J Neurosci. 26(21):5800-5809. PMID:16723538 - [
] Chen X, et al. (2006) "Interaction of acid-sensing ion channel (ASIC) 1 with the tarantula toxin psalmotoxin 1 is state dependent." J Gen Physiol. 127(3):267-276. PMID:16505147 - [
] Donier E, et al. (2005) "Annexin II light chain p11 promotes functional expression of acid-sensing ion channel ASIC1a." J Biol Chem. 280(46):38666-38672. PMID:16169854 - [
] Andrey F, et al. (2005) "Acid sensing ionic channels: modulation by redox reagents." Biochim Biophys Acta. 1745(1):1-6. PMID:16085050 - [
] Paukert M, et al. (2004) "Identification of the Ca2+ blocking site of acid-sensing ion channel (ASIC) 1: implications for channel gating." J Gen Physiol. 124(4):383-394. PMID:15452199 - [
] Xiong ZG, et al. (2004) "Neuroprotection in ischemia: blocking calcium-permeable acid-sensing ion channels." Cell. 118(6):687-698. PMID:15369669 - [
] Coric T, et al. (2003) "The extracellular domain determines the kinetics of desensitization in acid-sensitive ion channel 1." J Biol Chem. 278(46):45240-45247. PMID:12947112 - [
] Alvarez de la Rosa D, et al. (2003) "Distribution, subcellular localization and ontogeny of ASIC1 in the mammalian central nervous system." J Physiol. 546(Pt 1):77-87. PMID:12509480 - [
] Alvarez de la Rosa D, et al. (2002) "Functional implications of the localization and activity of acid-sensitive channels in rat peripheral nervous system." Proc Natl Acad Sci U S A. 99(4):2326-2331. PMID:11842212 - [
] Babini E, et al. (2002) "Alternative splicing and interaction with di- and polyvalent cations control the dynamic range of acid-sensing ion channel 1 (ASIC1)." J Biol Chem. 277(44):41597-41603. PMID:12198124 - [
] Chu XP, et al. (2002) "Proton-gated channels in PC12 cells." J Neurophysiol. 87(5):2555-2561. PMID:11976391 - [
] Voilley N, et al. (2001) "Nonsteroid anti-inflammatory drugs inhibit both the activity and the inflammation-induced expression of acid-sensing ion channels in nociceptors." J Neurosci. 21(20):8026-8033. PMID:11588175 - [
] Ugawa S, et al. (2001) "Cloning and functional expression of ASIC-beta2, a splice variant of ASIC-beta." Neuroreport. 12(13):2865-2869. PMID:11588592 - [
] Bassler EL, et al. (2001) "Molecular and functional characterization of acid-sensing ion channel (ASIC) 1b." J Biol Chem. 276(36):33782-33787. PMID:11448963 - [
] Askwith CC, et al. (2000) "Neuropeptide FF and FMRFamide potentiate acid-evoked currents from sensory neurons and proton-gated DEG/ENaC channels." Neuron. 26(1):133-141. PMID:10798398 - [
] Escoubas P, et al. (2000) "Isolation of a tarantula toxin specific for a class of proton-gated Na+ channels." J Biol Chem. 275(33):25116-25121. PMID:10829030 - [
] Chen CC, et al. (1998) "A sensory neuron-specific, proton-gated ion channel." Proc Natl Acad Sci U S A. 95(17):10240-10245. PMID:9707631 - [
] Bassilana F, et al. (1997) "The acid-sensitive ionic channel subunit ASIC and the mammalian degenerin MDEG form a heteromultimeric H+-gated Na+ channel with novel properties." J Biol Chem. 272(46):28819-28822. PMID:9360943 - [
] Waldmann R, et al. (1997) "A proton-gated cation channel involved in acid-sensing." Nature. 386(6621):173-177. PMID:9062189
The purpose of the present study was to investigate Acid Sensing Ion Channel (ASIC) protein expression and importance in cellular migration. We recently demonstrated that Epithelial Na(+)Channel (ENaC) proteins are required for vascular smooth muscle cell (VSMC) migration; however, the role of the closely related ASIC proteins has not been addressed. We used RT-PCR and immunolabeling to determine expression of ASIC1, ASIC2, ASIC3 and ASIC4 in A10 cells. We used small interference RNA to silence individual ASIC expression and determine the importance of ASIC proteins in wound healing and chemotaxis (PDGF-bb)-initiated migration. We found ASIC1, ASIC2, and ASIC3, but not ASIC4, expression in A10 cells. ASIC1, ASIC2, and ASIC3 siRNA molecules significantly suppressed expression of their respective proteins compared to non-targeting siRNA (RISC) transfected controls by 63%, 44%, and 55%, respectively. Wound healing was inhibited by 10, 20, and 26% compared to RISC controls following suppression of ASIC1, ASIC2, and ASIC3, respectively. Chemotactic migration was inhibited by 30% and 45%, respectively, following suppression of ASIC1 and ASIC3. ASIC2 suppression produced a small, but significant, increase in chemotactic migration (4%). Our data indicate that ASIC expression is required for normal migration and may suggest a novel role for ASIC proteins in cellular migration.
Acid-sensing ion channels (ASICs) are proton-gated cation channels found in peripheral and central nervous system neurons. The ASIC1a subtype, which has high Ca2+ permeability, is activated by ischemia-induced acidosis and contributes to the neuronal loss that accompanies ischemic stroke. Our laboratory has shown that activation of sigma receptors depresses ion channel activity and [Ca2+](i) dysregulation during ischemia, which enhances neuronal survival. Whole-cell patch-clamp electrophysiology and fluorometric Ca2+ imaging were used to determine whether sigma receptors regulate the function of ASIC in cultured rat cortical neurons. Bath application of the selective ASIC1a blocker, psalmotoxin1, decreased proton-evoked [Ca2+](i) transients and peak membrane currents, suggesting the presence of homomeric ASIC1a channels. The pan-selective sigma-1/sigma-2 receptor agonists, 1,3-di-o-tolyl-guanidine (100 microM) and opipramol (10 microM), reversibly decreased acid-induced elevations in [Ca2+](i) and membrane currents. Pharmacological experiments using sigma receptor-subtype-specific agonists demonstrated that sigma-1, but not sigma-2, receptors inhibit ASIC1a-induced Ca2+ elevations. These results were confirmed using the irreversible sigma receptor antagonist metaphit (50 microM) and the selective sigma-1 antagonist BD1063 (10 nM), which obtunded the inhibitory effects of the sigma-1 agonist, carbetapentane. Activation of ASIC1a was shown to stimulate downstream Ca2+ influx pathways, specifically N-methyl-D-aspartate and (+/-)-alpha-amino-3-hydroxy-5-methylisoxazole-4-propionic acid/kainate receptors and voltage-gated Ca2+ channels. These subsequent Ca2+ influxes were also inhibited upon activation of sigma-1 receptors. These findings demonstrate that sigma-1 receptor stimulation inhibits ASIC1a-mediated membrane currents and consequent intracellular Ca2+ accumulation. The ability to control ionic imbalances and Ca2+ dysregulation evoked by ASIC1a activation makes sigma receptors an attractive target for ischemic stroke therapy.
We investigated changes in pain behavior after injection of acetic acid in the hindpaws of rats with L5 spinal nerve ligation (SNL)-induced neuropathy. We also examined immunoreactivity for acid-sensing ion channel 3 (ASIC3) in the dorsal root ganglion (DRG) of rats with L5 SNL. Two weeks after SNL, the withdrawal threshold to a mechanical stimulus was significantly lower in the SNL group than in the sham-operated group (n=9 per group, P<0.01). After acetic acid injection, spontaneous pain responses in the SNL group were significantly increased compared to those in the sham-operated group (n=5, P<0.05). L5 SNL significantly increased the proportion of total ASIC3-immunoreactive (ir) neurons in the ipsilateral L4 DRG compared to that in sham-operated rats (n=4, P<0.01). Analysis of cell size showed that the proportion of large (>1200 mm(2)) ASIC3-ir neurons in the ipsilateral L4 DRG significantly increased after L5 SNL (P<0.05). In the ipsilateral L5 DRG, the proportion of ASIC3-ir neurons was not significantly affected by treatment. However, L5 SNL significantly increased (P<0.01) the proportion of small (<1200 mm(2)) ASIC3-ir neurons and significantly decreased (P<0.01) the proportion of large ASIC3-ir neurons compared to proportions in sham-operated animals. These findings suggest that ASIC3 is associated with hyperalgesia in response to a chemical stimulus in the L5 SNL rat model.
Acid-sensing ion channels (ASICs) are widely expressed in neurons, where they serve in pain and mechanical sensation, and contribute to learning and memory. Six ASIC subunit proteins form homo- or heteromeric channel complexes with distinct physiological properties. Of such complexes, only monomeric ASIC1a channels are Ca2+ permeable. Prior pharmacologic and genetic studies have shown that ASIC1a channel inactivation markedly diminishes CNS susceptibility to ischemic damage. Here, we characterize ASIC expression in oligodendrocyte lineage cells (OLC) by molecular, electrophysiological, calcium imaging, and immunofluorescence techniques. ASIC1a, ASIC2a, and ASIC4 mRNAs were expressed in cultured rat OLC, with steady-state levels of each of these mRNAs several-fold higher in oligodendroglial progenitors than in mature oligodendroglia. ASIC transcripts were also detected in brain white matter, and ASIC1a protein expression was detected in white matter oligodendroglia. Inactivating, proton-gated, amiloride-sensitive OLC currents were detected by whole-cell voltage clamp. These currents showed profound tachyphylaxis with slow recovery, and were predominantly blocked by psalmotoxin, indicating that homomeric ASIC1a comprised a large fraction of functional ASIC in the cultured OLC. ASIC activation substantially depolarized OLC plasma membrane in current clamp studies, and elicited transient elevations in intracellular Ca2+ in imaging studies. Thus, OLC ASIC1a channels provide a means by which an acid shift in CNS extracellular pH, by diminishing plasma membrane potential and increasing Ca2+ permeability, can activate OLC signaling pathways, and may contribute to OLC vulnerability to CNS ischemia.
The inhibitory action of non-steroid anti-inflammatory drugs was investigated on acid-sensing ionic channels (ASIC) in isolated hippocampal interneurons and on recombinant ASICs expressed in Chinese hamster ovary (CHO) cells. Diclofenac and ibuprofen inhibited proton-induced currents in hippocampal interneurons (IC(50) were 622 +/- 34 muM and 3.42 +/- 0.50 mM, respectively). This non-competitive effect was fast and fully reversible for both drugs. Aspirin and salicylic acid at 500 muM were ineffective. Diclofenac and ibuprofen decreased the amplitude of proton-evoked currents and slowed the rates of current decay with a good correlation between these effects. Simultaneous application of acid solution and diclofenac was required for its inhibitory effect. Unlike amiloride, the action of diclofenac was voltage-independent and no competition between two drugs was found. Analysis of the action of diclofenac and ibuprofen on activation and desensitization of ASICs showed that diclofenac but not ibuprofen shifted the steady-state desensitization curve to more alkaline pH values. The reason for this shift was slowing down the recovery from desensitization of ASICs. Thus, diclofenac may serve as a neuroprotective agent during pathological conditions associated with acidification.
Carotid body chemoreceptors sense hypoxemia, hypercapnia, and acidosis and play an important role in cardiorespiratory regulation. The molecular mechanism of pH sensing by chemoreceptors is not clear, although it has been proposed to be mediated by a drop in intracellular pH of carotid body glomus cells, which inhibits a K+ current. Recently, pH-sensitive ion channels have been described in glomus cells that respond directly to extracellular acidosis. In this study, we investigated the possible molecular mechanisms of carotid body pH sensing by recording the responses of glomus cells isolated from rat carotid body to rapid changes in extracellular pH using the whole-cell patch-clamping technique. Extracellular acidosis evoked transient inward current in glomus cells that was inhibited by the acid-sensing ion channel (ASIC) blocker amiloride, absent in Na+-free bathing solution, and enhanced by either Ca2+-free buffer or addition of lactate. In addition, ASIC1 and ASIC3 were shown to be expressed in rat carotid body by quantitative PCR and immunohistochemistry. In the current-clamp mode, extracellular acidosis evoked both a transient and sustained depolarizations. The initial transient component of depolarization was blocked by amiloride, whereas the sustained component was eliminated by removal of K+ from the pipette solution and partially blocked by the TASK (tandem-p-domain, acid-sensitive K+ channel) blockers anandamide and quinidine. The results provide the first evidence that ASICs may contribute to chemotransduction of low pH by carotid body chemoreceptors and that extracellular acidosis directly activates carotid body chemoreceptors through both ASIC and TASK channels.
Acid-sensing ion channel (ASIC) 1a and ASIC2a are acid-sensing ion channels in central and peripheral neurons. ASIC1a has been implicated in long-term potentiation of synaptic transmission and ischemic brain injury, whereas ASIC2a is involved in mechanosensation. Although the biological role and distribution of ASIC1a and ASIC2a subunits in brain have been well characterized, little is known about the intracellular regulation of these ion channels that modulates their function. Using pulldown assays and mass spectrometry, we have identified A kinase-anchoring protein (AKAP)150 and the protein phosphatase calcineurin as binding proteins to ASIC2a. Extended pulldown and co-immunoprecipitation assays showed that these regulatory proteins also interact with ASIC1a. Transfection of rat cortical neurons with constructs encoding green fluorescent protein- or hemagglutinin-tagged channels showed expression of ASIC1a and ASIC2a in punctate and clustering patterns in dendrites that co-localized with AKAP150. Inhibition of protein kinase A binding to AKAPs by Ht-31 peptide reduces ASIC currents in cortical neurons and Chinese hamster ovary cells, suggesting a role of AKAP150 in association with protein kinase A in ASIC function. We also demonstrated a regulatory function of calcineurin in ASIC1a and ASIC2a activity. Cyclosporin A, an inhibitor of calcineurin, increased ASIC currents in Chinese hamster ovary cells and in cortical neurons, suggesting that activity of ASICs is inhibited by calcineurin-dependent dephosphorylation. These data imply that ASIC down-regulation by calcineurin could play an important role under pathological conditions accompanying intracellular Ca(2+) overload and tissue acidosis to circumvent harmful activities mediated by these channels.
The homomeric acid-sensing ion channel 1a (ASIC1a) is a H+-activated ion channel with important physiological functions and pathophysiological impact in the central nervous system. Here we show that homomeric ASIC1a is distinguished from other ASICs by a reduced response to successive acid stimulations. Such a reduced response is called tachyphylaxis. We show that tachyphylaxis depends on H+ permeating through ASIC1a, that tachyphylaxis is attenuated by extracellular Ca2+, and that tachyphylaxis is probably linked to Ca2+ permeability of ASIC1a. Moreover, we provide evidence that tachyphylaxis is probably due to a long-lived inactive state of ASIC1a. A deeper understanding of ASIC1a tachyphylaxis may lead to pharmacological control of ASIC1a activity that could be of potential benefit for the treatment of stroke.
Several studies have suggested that acid-sensing ion channel 2 (ASIC2) plays a role in mechanoperception and acid sensing in the peripheral nervous system. We examined the expression and distribution of ASIC2 in the rat dorsal root ganglion, the co-localization of ASIC2 with tropomyosin-related kinase (trk) receptors, and the effects of axotomy on ASIC2 expression. ASIC2 immunoreactivity was observed in both neurons and satellite cells. ASIC2-positive neurons accounted for 16.5 +/- 2.4% of the total neurons in normal dorsal root ganglion. Most ASIC2-positive neurons were medium-to-large neurons and were labeled with neurofilament 200 kD (NF200). Within these neurons, ASIC2 was not evenly distributed throughout the cytoplasm, but rather was accumulated prominently in the cytoplasm adjacent to the axon hillock and axonal process. We next examined the co-localization of ASIC2 with trk receptors. trkA was expressed in few ASIC2-positive neurons, and trkB and trkC were observed in 85.2% and 53.4% of ASIC2-positive neurons, respectively, while only 6.9% of ASIC2-positive neurons were co-localized with trkC alone. Peripheral axotomy markedly reduced ASIC2 expression in the axotomized dorsal root ganglion neurons. On the other hand, intense ASIC2 staining was observed in satellite cells. These results show that ASIC2 is expressed in the distinct neurochemical population of sensory neurons as well as satellite cells, and that peripheral axotomy induced marked reductions in ASIC2 in neurons.
The action of extracellular protons on retinal activity and phototransduction occurs through pH-sensitive elements, mainly membrane conductances present on the different cell types of the outer and inner nuclear layers and of the ganglion cell layer. Acid-sensing ion channels (ASICs) are depolarizing conductances that are directly activated by protons. We investigated the participation of ASIC1a, a particular isoform of ASICs, in retinal physiology in vivo using electroretinogram measurements. In situ hybridization and immunohistochemistry localized ASIC1a in the outer and inner nuclear layers (cone photoreceptors, horizontal cells, some amacrine and bipolar cells) and in the ganglion cell layer. Both the in vivo knockdown of ASIC1a by antisense oligonucleotides and the in vivo blocking of its activity by PcTx1, a specific venom peptide, were able to decrease significantly and reversibly the photopic a- and b-waves and oscillatory potentials. Our study indicates that ASIC1a is an important channel in normal retinal activity. Being present in the inner segments of cones and inner nuclear layer cells, and mainly at synaptic cleft levels, it could participate in gain adaptation to ambient light of the cone pathway, facilitating cone hyperpolarization in brightness and modulating synaptic transmission of the light-induced visual signal.
Acid-sensing ion channels (ASICs) are Na(+) channels gated by extracellular H(+). Six ASIC subunits that are expressed in neurons have been characterized. The tarantula toxin psalmotoxin 1 has been reported to potently and specifically inhibit homomeric ASIC1a and has been useful to characterize ASICs in neurons. Recently we have shown that psalmotoxin 1 inhibits ASIC1a by increasing its apparent affinity for H(+). However, the mechanism by which PcTx1 increases the apparent H(+) affinity remained unclear. Here we show that PcTx1 also interacts with ASIC1b, a splice variant of ASIC1a. However, PcTx1 does not inhibit ASIC1b but promotes its opening; under slightly acidic conditions, PcTx1 behaves like an agonist for ASIC1b. Our results are most easily explained by binding of PcTx1 with different affinities to different states (closed, open, and desensitized) of the channel. For ASIC1b, PcTx1 binds most tightly to the open state, promoting opening, whereas for ASIC1a, it binds most tightly to the open and the desensitized state, promoting desensitization.
Acid-sensing ion channels (ASICs) have been implicated in a wide variety of physiological functions. We have used a rat dorsal root ganglion cDNA library in a yeast two-hybrid assay to identify sensory neuron proteins that interact with ASICs. We found that annexin II light chain p11 physically interacts with the N terminus of ASIC1a, but not other ASIC isoforms. Immunoprecipitation studies confirmed an interaction between p11 and ASIC1 in rat dorsal root ganglion neurons in vivo. Coexpression of p11 and ASIC1a in CHO-K1 cells led to a 2-fold increase in expression of the ion channel at the cell membrane as determined by membrane-associated immunoreactivity and cell-surface biotinylation. Consistent with these findings, peak ASIC1a currents in transfected CHO-K1 cells were up-regulated 2-fold in the presence of p11, whereas ASIC3-mediated currents were unaffected by p11 expression. Neither the pH dependence of activation nor the rates of desensitization were altered by p11, suggesting that its primary role in regulating ASIC1a activity is to enhance cell-surface expression of ASIC1a. These data demonstrate that p11, already known to traffic members of the voltage-gated sodium and potassium channel families as well as transient receptor potential and chloride channels, also plays a selective role in enhancing ASIC1a functional expression.
Acid-sensing ion channels (ASICs) are widely expressed in mammalian sensory neurons and supposedly play a role in nociception and acid sensing. In the course of functioning the redox status of the tissue is subjected to changes. Using whole-cell patch-clamp/concentration clamp techniques we have investigated the effect of redox reagents on the ASIC-like currents in the sensory ganglia and hippocampal neurons of rat. The reducing agent dithiothreitol (DTT), when applied in the concentrations 1-2 mM, reversibly potentiates proton-activated currents, while the oxidizing reagent 5,5'-dithio-bis-(2-nitrobenzoic acid) (DTNB) causes their inhibition. The EC50 and Hill coefficient for the activation of ASIC-like currents by protons are not affected by DTT. Redox modulation of proton-activated currents is independent on the membrane potential and on the level of pH used for the current activation. The endogenous antioxidant tripeptide glutathione (its reduced form, g-l-glutamyl-l-cysteinyl-glycine, GSH) also potentiates proton-activated currents. Our results indicate that ASIC-like currents are susceptible to regulation by redox agents.
Acid-sensing ion channels ASIC1a and ASIC1b are ligand-gated ion channels that are activated by H+ in the physiological range of pH. The apparent affinity for H+ of ASIC1a and 1b is modulated by extracellular Ca2+ through a competition between Ca2+ and H+. Here we show that, in addition to modulating the apparent H+ affinity, Ca2+ blocks ASIC1a in the open state (IC50 approximately 3.9 mM at pH 5.5), whereas ASIC1b is blocked with reduced affinity (IC50 > 10 mM at pH 4.7). Moreover, we report the identification of the site that mediates this open channel block by Ca2+. ASICs have two transmembrane domains. The second transmembrane domain M2 has been shown to form the ion pore of the related epithelial Na+ channel. Conserved topology and high homology in M2 suggests that M2 forms the ion pore also of ASICs. Combined substitution of an aspartate and a glutamate residue at the beginning of M2 completely abolished block by Ca2+ of ASIC1a, showing that these two amino acids (E425 and D432) are crucial for Ca2+ block. It has previously been suggested that relief of Ca2+ block opens ASIC3 channels. However, substitutions of E425 or D432 individually or in combination did not open channels constitutively and did not abolish gating by H+ and modulation of H+ affinity by Ca2+. These results show that channel block by Ca2+ and H+ gating are not intrinsically linked.
Ca2+ toxicity remains the central focus of ischemic brain injury. The mechanism by which toxic Ca2+ loading of cells occurs in the ischemic brain has become less clear as multiple human trials of glutamate antagonists have failed to show effective neuroprotection in stroke. Acidosis is a common feature of ischemia and is assumed to play a critical role in brain injury; however, the mechanism(s) remain ill defined. Here, we show that acidosis activates Ca2+ -permeable acid-sensing ion channels (ASICs), inducing glutamate receptor-independent, Ca2+ -dependent, neuronal injury inhibited by ASIC blockers. Cells lacking endogenous ASICs are resistant to acid injury, while transfection of Ca2+ -permeable ASIC1a establishes sensitivity. In focal ischemia, intracerebroventricular injection of ASIC1a blockers or knockout of the ASIC1a gene protects the brain from ischemic injury and does so more potently than glutamate antagonism. Thus, acidosis injures the brain via membrane receptor-based mechanisms with resultant toxicity of [Ca2+]i, disclosing new potential therapeutic targets for stroke.
The acid-sensitive ion channel 1 (ASIC1alpha or BNaC2a) is the most abundant of all mammalian proton-gated ion channels and the one that has the broadest distribution in the nervous system. Hallmarks of ASIC1alpha are gating by external protons and rapid desensitization. In sensory neurons ASIC1 may constitute a nociceptor for pain induced by local acidification, whereas in central neurons it may modulate synaptic activity. To gain insight into the functional roles of ASIC1, we cloned and examined the properties of the evolutionarily distant species toadfish (Opsanus tau), approximately 420-million year divergent from mammals. Analysis of the protein sequence from fish ASIC1 revealed 76% amino acid identity with the rat orthologue. The regions of highest conservation are the second transmembrane domain and the ectodomain, whereas the amino and carboxyl termini and first transmembrane domain are poorly conserved. At the functional level, fish ASIC1 is gated by external protons with a half-maximal activation at pHo 5.6 and a half-maximal inactivation at pHo 7.30. The fish differs from the rat channel on having a 25-fold faster rate of desensitization. Functional studies of chimeras made from rat and fish ASIC1 indicate that the extracellular domain specifically, a cluster of three residues, confers the faster desensitization rate to the fish ASIC1.
The acid-sensitive ion channel ASIC1 is a proton-gated ion channel from the mammalian nervous system. Its expression in sensory neurons and activation by low extracellular pH suggest that ASIC is involved in transmitting nociceptive impulses produced by the acidification caused by injury or inflammation. However, ASIC1 expression is not restricted to sensory neurons. To understand the functional role of ASIC1 in the CNS we investigated its expression and subcellular distribution therein. In particular, we examined the presence of ASIC1 in domains where the local pH may drop sufficiently to activate ASIC1 under physiological conditions. Immunostaining with specific antibodies revealed broad expression of ASIC1 in many areas of the adult rat brain including the cerebral cortex, hippocampus and cerebellum. Within cells, ASIC1 was found predominantly throughout the soma and along the branches of axons and dendrites. ASIC1 was not enriched in the microdomains where pH may reach low values, such as in synaptic vesicles or synaptic membranes. Pre- or postsynaptic ASIC1 was not gated by synaptic activity in cultured hippocampal neurons. Blockage or desensitization of ASIC1 with amiloride or pH 6.7, respectively, did not modify postsynaptic currents. Finally, the ontogeny of ASIC1 in mouse brain revealed constant levels of expression of ASIC1 protein from embryonic day 12 to the postnatal period, indicating an early and almost constant level of expression of ASIC1 during brain development.
Acid-sensitive ion channels (ASIC) are proton-gated ion channels expressed in neurons of the mammalian central and peripheral nervous systems. The functional role of these channels is still uncertain, but they have been proposed to constitute mechanoreceptors and/or nociceptors. We have raised specific antibodies for ASIC1, ASIC2, ASIC3, and ASIC4 to examine the distribution of these proteins in neurons from dorsal root ganglia (DRG) and to determine their subcellular localization. Western blot analysis demonstrates that all four ASIC proteins are expressed in DRG and sciatic nerve. Immunohistochemical experiments and functional measurements of unitary currents from the ASICs with the patch-clamp technique indicate that ASIC1 localizes to the plasma membrane of small-, medium-, and large-diameter cells, whereas ASIC2 and ASIC3 are preferentially in medium to large cells. Neurons coexpressing ASIC2 and ASIC3 form predominantly heteromeric ASIC2-3 channels. Two spliced forms, ASIC2a and ASIC2b, colocalize in the same population of DRG neurons. Within cells, the ASICs are present mainly on the plasma membrane of the soma and cellular processes. Functional studies indicate that the pH sensitivity for inactivation of ASIC1 is much higher than the one for activation; hence, increases in proton concentration will inactivate the channel. These functional properties and localization in DRG have profound implications for the putative functional roles of ASICs in the nervous system.
Homomeric acid-sensing ion channel 1 (ASIC1) can be activated by extracellular H(+) in the physiological pH range and may, therefore, contribute to neurotransmission and peripheral pain perception. ASIC1a and ASIC1b are alternative splice products of the ASIC1 gene. Here we show that both splice variants show steady-state inactivation when exposed to slightly decreased pH, limiting their operational range. Compared with ASIC1a, steady-state inactivation and pH activation of ASIC1b are shifted to more acidic values by 0.25 and 0.7 pH units, respectively, extending the dynamic range of ASIC1. Shifts of inactivation and activation are intimately linked; only two amino acids in the ectodomain, which are exchanged by alternative splicing, control both properties. Moreover, we show that extracellular, divalent cations like Ca(2+) and Mg(2+) as well as the polyvalent cation spermine shift the steady-state inactivation of ASIC1a and ASIC1b to more acidic values. This leads to a potentiation of the channel response and is due to a stabilization of the resting state. Our results indicate that ASIC1b is an effective sensor of transient H(+) signals during slight acidosis and that, in addition to alternative splicing, interaction with di- and polyvalent cations extends the dynamic range of ASIC H(+) sensors.
Acid-sensing ion channels (ASICs) are expressed in various sensory and central neurons. The functional role of these channels remains elusive. Complex subunit combinations and lack of specific blockers for native receptors are likely to contribute to the difficulty of resolving the function of ASICs. Finding a neuronal cell line, which expresses a single population of ASICs, should prove to be useful in delineating the function of individual ASICs. Using patch-clamp, Ca(2+)-imaging, and RT-PCR techniques, we have explored the existence of ASICs in PC12 cells, a clonal neuronal cell line. Fast drops of extracellular pH activated transient inward currents in PC12 cells with pH(0.5) at 6.0-6.2. The ASICs in PC12 cells were selective for Na(+) with significant Ca(2+) permeability. Currents in PC12 cells were blocked by the nonselective ASIC blocker amiloride. PcTX1, a specific homomeric ASIC1a blocker, also blocked the ASIC currents with an IC(50) of approximately 1.5 nM. RT-PCR demonstrated the existence of ASIC1a transcript in both undifferentiated and nerve growth factor-differentiated PC12 cells. Our data suggest that PC12 cells likely contain a single population of functional proton-gated channel-homomeric ASIC1a. It might be an ideal neuronal cell line for the study of physiological and potential pathological roles of this key subunit of ASICs.
Nonsteroid anti-inflammatory drugs (NSAIDs) are major drugs against inflammation and pain. They are well known inhibitors of cyclooxygenases (COXs). However, many studies indicate that they may also act on other targets. Acidosis is observed in inflammatory conditions such as chronic joint inflammation, in tumors and after ischemia, and greatly contributes to pain and hyperalgesia. Administration of NSAIDs reduces low-pH-induced pain. The acid sensitivity of nociceptors is associated with activation of H(+)-gated ion channels. Several of these, cloned recently, correspond to the acid-sensing ion channels (ASICs) and others to the vanilloid receptor family. This paper shows (1) that ASIC mRNAs are present in many small sensory neurons along with substance P and isolectin B4 and that, in case of inflammation, ASIC1a appears in some larger Abeta fibers, (2) that NSAIDs prevent the large increase of ASIC expression in sensory neurons induced by inflammation, and (3) that NSAIDs such as aspirin, diclofenac, and flurbiprofen directly inhibit ASIC currents on sensory neurons and when cloned ASICs are heterologously expressed. These results suggest that the combined capacity to block COXs and inhibit both inflammation-induced expression and activity of ASICs present in nociceptors is an important factor in the action of NSAIDs against pain.
We have isolated a cDNA encoding a splice variant of ASIC (acid-sensing ion channel)-beta from the rat trigeminal ganglion. This clone, designated ASIC-beta2, showed a 342 base deletion just after the first transmembrane domain in ASIC-beta. RT-PCR experiments revealed that ASIC-beta2 was expressed exclusively in the trigeminal ganglion and dorsal root ganglion. In situ hybridization showed that ASIC-beta2 mRNA was concentrated in both small diameter and large diameter neurons and co-localized with ASIC-beta mRNA within single sensory neurons in the trigeminal ganglion. When expressed in Xenopus oocytes, ASIC-beta2 was inactive by itself. However, it associated with ASIC-beta to form heteromers, which display lower affinity for protons than ASIC-beta alone.
Acid-sensing ion channels (ASICs) are activated by extracellular protons and are involved in neurotransmission in the central nervous system, in pain perception, as well as in mechanotransduction. Six different ASIC subunits have been cloned to date, which are encoded by four genes (ASIC1-ASIC4). Proton-gated currents have been described in isolated neurons from sensory ganglia as well as from central nervous system. However, it is largely unclear which of the cloned ASIC subunits underlie these native proton-gated currents. Recently, a splice variant, ASIC-beta, has been described for ASIC1a. In this variant about one-third of the protein is exchanged at the N terminus. Here we show that ASIC-beta has a longer N terminus than previously reported, extending the sequence divergence between ASIC1a and this new variant (ASIC1b). We investigated in detail kinetic and selectivity properties of ASIC1b in comparison to ASIC1a. Kinetics is similar for ASIC1b and ASIC1a. Ca(2+) permeability of ASIC1a is low, whereas ASIC1b is impermeable to Ca(2+). Currents through ASIC1a resemble currents, which have been described in sensory and central neurons, whereas the significance of ASIC1b remains to be established. Moreover, we show that a pre-transmembrane 1 domain controls the permeability to divalent cations in ASIC1, contributing to our understanding of the pore structure of these channels.
Acidosis is associated with inflammation and ischemia and activates cation channels in sensory neurons. Inflammation also induces expression of FMRFamidelike neuropeptides, which modulate pain. We found that neuropeptide FF (Phe-Leu-Phe-Gln-Pro-Gln-Arg-Phe amide) and FMRFamide (Phe-Met-Arg-Phe amide) generated no current on their own but potentiated H+-gated currents from cultured sensory neurons and heterologously expressed ASIC and DRASIC channels. The neuropeptides slowed inactivation and induced sustained currents during acidification. The effects were specific; different channels showed distinct responses to the various peptides. These results suggest that acid-sensing ion channels may integrate multiple extracellular signals to modify sensory perception.
Acid sensing is associated with nociception, taste transduction, and perception of extracellular pH fluctuations in the brain. Acid sensing is carried out by the simplest class of ligand-gated channels, the family of H(+)-gated Na(+) channels. These channels have recently been cloned and belong to the acid-sensitive ion channel (ASIC) family. Toxins from animal venoms have been essential for studies of voltage-sensitive and ligand-gated ion channels. This paper describes a novel 40-amino acid toxin from tarantula venom, which potently blocks (IC(50) = 0.9 nm) a particular subclass of ASIC channels that are highly expressed in both central nervous system neurons and sensory neurons from dorsal root ganglia. This channel type has properties identical to those described for the homomultimeric assembly of ASIC1a. Homomultimeric assemblies of other members of the ASIC family and heteromultimeric assemblies of ASIC1a with other ASIC subunits are insensitive to the toxin. The new toxin is the first high affinity and highly selective pharmacological agent for this novel class of ionic channels. It will be important for future studies of their physiological and physio-pathological roles.
Proton-gated channels expressed by sensory neurons are of particular interest because low pH causes pain. Two proton-gated channels, acid-sensing ionic channel (ASIC) and dorsal root ASIC (DRASIC), that are members of the amiloride-sensitive ENaC/Degenerin family are known to be expressed by sensory neurons. Here, we describe the cloning and characterization of an ASIC splice variant, ASIC-beta, which contains a unique N-terminal 172 aa, as well as unique 5' and 3' untranslated sequences. ASIC-beta, unlike ASIC and DRASIC, is found only in a subset of small and large diameter sensory neurons and is absent from sympathetic neurons or the central nervous system. The patterns of expression of ASIC and ASIC-beta transcripts in rat dorsal root ganglion neurons are distinct. When expressed in COS-7 cells, ASIC-beta forms a functional channel with electrophysiological properties distinct from ASIC and DRASIC. The pH dependency and sensitivity to amiloride of ASIC-beta is similar to that described for ASIC, but unlike ASIC, the channel is not permeable to calcium, nor are ASIC-beta-mediated currents inhibited by extracellular calcium. The unique distribution of ASIC-beta suggests that it may play a specialized role in sensory neuron function.
Proton-gated cation channels are acid sensors that are present in both sensory neurons and in neurons of the central nervous system. One of these acid-sensing ion channels (ASIC) has been recently cloned. This paper shows that ASIC and the mammalian degenerin MDEG, which are colocalized in the same brain regions, can directly associate with each other. Immunoprecipitation of MDEG causes coprecipitation of ASIC. Moreover, coexpression of ASIC and MDEG subunits in Xenopus oocytes generates an amiloride-sensitive H+-gated Na+ channel with novel properties (different kinetics, ionic selectivity, and pH sensitivity). In addition, coexpression of MDEG with mutants of the ASIC subunit can create constitutively active channels that become completely nonselective for Na+ versus K+ and H+-gated channels that have a drastically altered pH sensitivity compared with MDEG. These data clearly show that ASIC and MDEG can form heteromultimeric assemblies with novel properties. Heteromultimeric assembly is probably used for creating a diversity of H+-gated cation channels acting as neuronal acid sensors in different pH ranges.
Acid-sensing is associated with both nociception and taste transduction. Stimulation of sensory neurons by acid is of particular interest, because acidosis accompanies many painful inflammatory and ischaemic conditions. The pain caused by acids is thought to be mediated by H+-gated cation channels present in sensory neurons. We have now cloned a H+-gated channel (ASIC, for acid-sensing ionic channel) that belongs to the amiloride-sensitive Na+ channel/degenerin family of ion channels. Heterologous expression of ASIC induces an amiloride-sensitive cation (Na+ > Ca2+ > K+) channel which is transiently activated by rapid extracellular acidification. The biophysical and pharmacological properties of the ASIC channel closely match the H+-gated cation channel described in sensory neurons. ASIC is expressed in dorsal root ganglia and is also distributed widely throughout the brain. ASIC appears to be the simplest of ligand-gated channels.