Accn2 | GeneID:79123 | Rattus norvegicus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 79123 Official Symbol Accn2
Locus N/A Gene Type protein-coding
Synonyms Asic1
Full Name amiloride-sensitive cation channel 2, neuronal
Description amiloride-sensitive cation channel 2, neuronal
Chromosome 7q36
Also Known As proton gated cation channel ASIC1
Summary forms a proton-gated ion channel that may play a role in sensory neuron function and pain perception [RGD]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 37440

ID Symbol Protein Species
GeneID:41 ACCN2 NP_001086.2 Homo sapiens
GeneID:11419 Accn2 NP_033727.1 Mus musculus
GeneID:79123 Accn2 NP_077068.1 Rattus norvegicus
GeneID:171992 C24G7.4 NP_491293.1 Caenorhabditis elegans
GeneID:181468 flr-1 NP_510243.1 Caenorhabditis elegans
GeneID:182851 C24G7.1 NP_491296.1 Caenorhabditis elegans
GeneID:182852 C24G7.2 NP_491295.2 Caenorhabditis elegans
GeneID:182963 tag-324 NP_510463.2 Caenorhabditis elegans
GeneID:184882 F23B2.3 NP_501590.2 Caenorhabditis elegans
GeneID:185036 F28A12.1 NP_505230.1 Caenorhabditis elegans
GeneID:189051 T28F2.7 NP_491196.2 Caenorhabditis elegans
GeneID:407670 accn2c NP_999954.1 Danio rerio
GeneID:426883 ACCN2 NP_001035557.1 Gallus gallus
GeneID:451888 ACCN2 XP_001155207.1 Pan troglodytes

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab65698 ACCN2 antibody (ab65698); Rabbit polyclonal to ACCN2
2 sigma S7944 Anti-Sodium Channel ASIC1 antibody produced in rabbit ;

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005887 Component integral to plasma membrane
GO:0019717 Component synaptosome
GO:0005261 Function cation channel activity
GO:0005216 Function ion channel activity
GO:0005515 Function protein binding
GO:0008306 Process associative learning
GO:0006812 Process cation transport
GO:0007613 Process memory
GO:0001101 Process response to acid
GO:0019233 Process sensory perception of pain

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_024154  UCSC Browser NP_077068

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSRNOT00000025476 MI0005560 hsa-miR-885-3p AGGCAGCGGGGUGUAGUGGAUA
ENSRNOT00000025476 MI0005763 hsa-miR-941 CACCCGGCUGUGUGCACAUGUGC
ENSRNOT00000025476 MI0005764 hsa-miR-941 CACCCGGCUGUGUGCACAUGUGC
ENSRNOT00000025476 MI0005765 hsa-miR-941 CACCCGGCUGUGUGCACAUGUGC
ENSRNOT00000025476 MI0005766 hsa-miR-941 CACCCGGCUGUGUGCACAUGUGC
ENSRNOT00000025476 MI0000865 rno-miR-29c* UGACCGAUUUCUCCUGGUGUUC
ENSRNOT00000025476 MI0000622 rno-miR-340-3p UCCGUCUCAGUUACUUUAUAGCC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Grifoni SC, et al. (2008) "ASIC proteins regulate smooth muscle cell migration." Microvasc Res. 75(2):202-210. PMID:17936312
  2. [ + ] Herrera Y, et al. (2008) "sigma-1 receptor modulation of acid-sensing ion channel a (ASIC1a) and ASIC1a-induced Ca2+ influx in rat cortical neurons." J Pharmacol Exp Ther. 327(2):491-502. PMID:18723775
  3. [ + ] Omori M, et al. (2008) "Effects of selective spinal nerve ligation on acetic acid-induced nociceptive responses and ASIC3 immunoreactivity in the rat dorsal root ganglion." Brain Res. 1219():26-31. PMID:18534561
  4. [ + ] Feldman DH, et al. (2008) "Characterization of acid-sensing ion channel expression in oligodendrocyte-lineage cells." Glia. 56(11):1238-1249. PMID:18452213
  5. [ + ] Dorofeeva NA, et al. (2008) "Mechanisms of non-steroid anti-inflammatory drugs action on ASICs expressed in hippocampal interneurons." J Neurochem. 106(1):429-441. PMID:18410516
  6. [ + ] Tan ZY, et al. (2007) "Acid-sensing ion channels contribute to transduction of extracellular acidosis in rat carotid body glomus cells." Circ Res. 101(10):1009-1019. PMID:17872465
  7. [ + ] Chai S, et al. (2007) "A kinase-anchoring protein 150 and calcineurin are involved in regulation of acid-sensing ion channels ASIC1a and ASIC2a." J Biol Chem. 282(31):22668-22677. PMID:17548344
  8. [ + ] Chen X, et al. (2007) "Permeating protons contribute to tachyphylaxis of the acid-sensing ion channel (ASIC) 1a." J Physiol. 579(Pt 3):657-670. PMID:17204502
  9. [ + ] Kawamata T, et al. (2006) "Immunohistochemical analysis of acid-sensing ion channel 2 expression in rat dorsal root ganglion and effects of axotomy." Neuroscience. 143(1):175-187. PMID:16949762
  10. [ + ] Ettaiche M, et al. (2006) "Silencing acid-sensing ion channel 1a alters cone-mediated retinal function." J Neurosci. 26(21):5800-5809. PMID:16723538
  11. [ + ] Chen X, et al. (2006) "Interaction of acid-sensing ion channel (ASIC) 1 with the tarantula toxin psalmotoxin 1 is state dependent." J Gen Physiol. 127(3):267-276. PMID:16505147
  12. [ + ] Donier E, et al. (2005) "Annexin II light chain p11 promotes functional expression of acid-sensing ion channel ASIC1a." J Biol Chem. 280(46):38666-38672. PMID:16169854
  13. [ + ] Andrey F, et al. (2005) "Acid sensing ionic channels: modulation by redox reagents." Biochim Biophys Acta. 1745(1):1-6. PMID:16085050
  14. [ + ] Paukert M, et al. (2004) "Identification of the Ca2+ blocking site of acid-sensing ion channel (ASIC) 1: implications for channel gating." J Gen Physiol. 124(4):383-394. PMID:15452199
  15. [ + ] Xiong ZG, et al. (2004) "Neuroprotection in ischemia: blocking calcium-permeable acid-sensing ion channels." Cell. 118(6):687-698. PMID:15369669
  16. [ + ] Coric T, et al. (2003) "The extracellular domain determines the kinetics of desensitization in acid-sensitive ion channel 1." J Biol Chem. 278(46):45240-45247. PMID:12947112
  17. [ + ] Alvarez de la Rosa D, et al. (2003) "Distribution, subcellular localization and ontogeny of ASIC1 in the mammalian central nervous system." J Physiol. 546(Pt 1):77-87. PMID:12509480
  18. [ + ] Alvarez de la Rosa D, et al. (2002) "Functional implications of the localization and activity of acid-sensitive channels in rat peripheral nervous system." Proc Natl Acad Sci U S A. 99(4):2326-2331. PMID:11842212
  19. [ + ] Babini E, et al. (2002) "Alternative splicing and interaction with di- and polyvalent cations control the dynamic range of acid-sensing ion channel 1 (ASIC1)." J Biol Chem. 277(44):41597-41603. PMID:12198124
  20. [ + ] Chu XP, et al. (2002) "Proton-gated channels in PC12 cells." J Neurophysiol. 87(5):2555-2561. PMID:11976391
  21. [ + ] Voilley N, et al. (2001) "Nonsteroid anti-inflammatory drugs inhibit both the activity and the inflammation-induced expression of acid-sensing ion channels in nociceptors." J Neurosci. 21(20):8026-8033. PMID:11588175
  22. [ + ] Ugawa S, et al. (2001) "Cloning and functional expression of ASIC-beta2, a splice variant of ASIC-beta." Neuroreport. 12(13):2865-2869. PMID:11588592
  23. [ + ] Bassler EL, et al. (2001) "Molecular and functional characterization of acid-sensing ion channel (ASIC) 1b." J Biol Chem. 276(36):33782-33787. PMID:11448963
  24. [ + ] Askwith CC, et al. (2000) "Neuropeptide FF and FMRFamide potentiate acid-evoked currents from sensory neurons and proton-gated DEG/ENaC channels." Neuron. 26(1):133-141. PMID:10798398
  25. [ + ] Escoubas P, et al. (2000) "Isolation of a tarantula toxin specific for a class of proton-gated Na+ channels." J Biol Chem. 275(33):25116-25121. PMID:10829030
  26. [ + ] Chen CC, et al. (1998) "A sensory neuron-specific, proton-gated ion channel." Proc Natl Acad Sci U S A. 95(17):10240-10245. PMID:9707631
  27. [ + ] Bassilana F, et al. (1997) "The acid-sensitive ionic channel subunit ASIC and the mammalian degenerin MDEG form a heteromultimeric H+-gated Na+ channel with novel properties." J Biol Chem. 272(46):28819-28822. PMID:9360943
  28. [ + ] Waldmann R, et al. (1997) "A proton-gated cation channel involved in acid-sensing." Nature. 386(6621):173-177. PMID:9062189