ABCB10 | GeneID:789800 | Bos taurus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 789800 Official Symbol ABCB10
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description ATP-binding cassette, sub-family B (MDR/TAP), member 10
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 6474

ID Symbol Protein Species
GeneID:23456 ABCB10 NP_036221.1 Homo sapiens
GeneID:30994 CG3156 NP_569844.2 Drosophila melanogaster
GeneID:56199 Abcb10 NP_062425.1 Mus musculus
GeneID:178522 haf-1 NP_503098.2 Caenorhabditis elegans
GeneID:180056 haf-3 NP_506927.1 Caenorhabditis elegans
GeneID:361439 Abcb10 NP_001012166.1 Rattus norvegicus
GeneID:421537 ABCB10 XP_419578.2 Gallus gallus
GeneID:789800 ABCB10 XP_001256449.1 Bos taurus
GeneID:814343 MAL3P1.7 XP_001351101.1 Plasmodium falciparum
GeneID:833896 ATTAP2 NP_198720.2 Arabidopsis thaliana
GeneID:855858 MDL2 NP_015053.2 Saccharomyces cerevisiae
GeneID:1273250 AgaP_AGAP002717 XP_563428.1 Anopheles gambiae
GeneID:2541285 mdl1 NP_595751.1 Schizosaccharomyces pombe
GeneID:2685051 MGG_06878 XP_370381.2 Magnaporthe grisea
GeneID:2705539 NCU04117.1 XP_323457.1 Neurospora crassa
GeneID:2893314 KLLA0D00748g XP_453105.1 Kluyveromyces lactis
GeneID:4334151 Os03g0755100 NP_001051311.1 Oryza sativa
GeneID:4619550 AGOS_ACR022W NP_983425.1 Eremothecium gossypii
GeneID:100003744 LOC100003744 XP_001343218.2 Danio rerio

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0016887 Function ATPase activity
GO:0042626 Function ATPase activity, coupled to transmembrane movement of substances
GO:0005524 Function ATP binding
GO:0000166 Function nucleotide binding
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_001256448 XP_001256449

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSBTAT00000022677 MI0005008 bta-miR-127 UCGGAUCCGUCUGAGCUUGGCU
ENSBTAT00000022677 MI0005011 bta-miR-142 CAUAAAGUAGAAAGCACUAC
ENSBTAT00000022677 MI0005014 bta-miR-193a AACUGGCCUACAAAGUCCCAGU
ENSBTAT00000022677 MI0005020 bta-miR-369-3p AAUAAUACAUGGUUGAUCUUU
ENSBTAT00000022677 MI0005056 bta-miR-7 UGGAAGACUAGUGAUUUUGUUGUU
ENSBTAT00000022677 MI0000779 hsa-miR-371-3p AAGUGCCGCCAUCUUUUGAGUGU
ENSBTAT00000022677 MI0000790 hsa-miR-382 GAAGUUGUUCGUGGUGGAUUCG
ENSBTAT00000022677 MI0003125 hsa-miR-490-3p CAACCUGGAGGACUCCAUGCUG
ENSBTAT00000022677 MI0003170 hsa-miR-518a-5p CUGCAAAGGGAAGCCCUUUC
ENSBTAT00000022677 MI0003173 hsa-miR-518a-5p CUGCAAAGGGAAGCCCUUUC
ENSBTAT00000022677 MI0003146 hsa-miR-520f AAGUGCUUCCUUUUAGAGGGUU
ENSBTAT00000022677 MI0003686 hsa-miR-542-3p UGUGACAGAUUGAUAACUGAAA
ENSBTAT00000022677 MI0003612 hsa-miR-548a-5p AAAAGUAAUUGCGAGUUUUACC
ENSBTAT00000022677 MI0003630 hsa-miR-548c-5p AAAAGUAAUUGCGGUUUUUGCC
ENSBTAT00000022677 MI0003668 hsa-miR-548d-5p AAAAGUAAUUGUGGUUUUUGCC
ENSBTAT00000022677 MI0003671 hsa-miR-548d-5p AAAAGUAAUUGUGGUUUUUGCC
ENSBTAT00000022677 MI0003576 hsa-miR-569 AGUUAAUGAAUCCUGGAAAGU
ENSBTAT00000022677 MI0003578 hsa-miR-571 UGAGUUGGCCAUCUGAGUGAG
ENSBTAT00000022677 MI0003580 hsa-miR-573 CUGAAGUGAUGUGUAACUGAUCAG
ENSBTAT00000022677 MI0003589 hsa-miR-582-3p UAACUGGUUGAACAACUGAACC
ENSBTAT00000022677 MI0003677 hsa-miR-655 AUAAUACAUGGUUAACCUCUUU
ENSBTAT00000022677 MI0003760 hsa-miR-671-5p AGGAAGCCCUGGAGGGGCUGGAG
ENSBTAT00000022677 MI0005714 hsa-miR-922 GCAGCAGAGAAUAGGACUACGUC
ENSBTAT00000022677 MI0000388 mmu-miR-290-3p AAAGUGCCGCCUAGUUUUAAGCCC
ENSBTAT00000022677 MI0000390 mmu-miR-292-3p AAAGUGCCGCCAGGUUUUGAGUGU
ENSBTAT00000022677 MI0005498 mmu-miR-465b-5p UAUUUAGAAUGGUGCUGAUCUG
ENSBTAT00000022677 MI0005499 mmu-miR-465b-5p UAUUUAGAAUGGUGCUGAUCUG
ENSBTAT00000022677 MI0005504 mmu-miR-466b-3-3p AAUACAUACACGCACACAUAAGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene