AARS2 | GeneID:786099 | Bos taurus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 786099 Official Symbol AARS2
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description alanyl-tRNA synthetase 2, mitochondrial (putative)
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 56897

ID Symbol Protein Species
GeneID:57505 AARS2 NP_065796.1 Homo sapiens
GeneID:224805 Aars2 NP_941010.2 Mus musculus
GeneID:301254 Aars2 XP_236942.4 Rattus norvegicus
GeneID:421436 RCJMB04_28n18 NP_001026227.1 Gallus gallus
GeneID:462733 AARS2 XP_518510.2 Pan troglodytes
GeneID:474920 AARS2 XP_532155.2 Canis lupus familiaris
GeneID:786099 AARS2 XP_001253240.1 Bos taurus
GeneID:792787 si:dkey-240e12.1 XP_001332388.2 Danio rerio

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0004813 Function alanine-tRNA ligase activity
GO:0005524 Function ATP binding
GO:0016876 Function ligase activity, forming aminoacyl-tRNA and related compounds
GO:0003676 Function nucleic acid binding
GO:0000166 Function nucleotide binding
GO:0006419 Process alanyl-tRNA aminoacylation
GO:0006412 Process translation
GO:0043039 Process tRNA aminoacylation

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_001253239 XP_001253240

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSBTAT00000018232 MI0005028 bta-miR-132 UAACAGUCUACAGCCAUGGUCG
ENSBTAT00000018232 MI0005014 bta-miR-193a* UGGGUCUUUGCGGGCGAGAUGA
ENSBTAT00000018232 MI0004759 bta-miR-205 UCCUUCAUUCCACCGGAGUCUG
ENSBTAT00000018232 MI0005039 bta-miR-210 ACUGUGCGUGUGACAGCGGCUGA
ENSBTAT00000018232 MI0005067 bta-miR-25 CAUUGCACUUGUCUCGGUCUGA
ENSBTAT00000018232 MI0004749 bta-miR-484 UCAGGCUCAGUCCCCUCCCGAU
ENSBTAT00000018232 MI0000262 hsa-miR-147 GUGUGUGGAAAUGCUUCUGC
ENSBTAT00000018232 MI0000478 hsa-miR-149 UCUGGCUCCGUGUCUUCACUCCC
ENSBTAT00000018232 MI0000288 hsa-miR-212 UAACAGUCUCCAGUCACGGCC
ENSBTAT00000018232 MI0000292 hsa-miR-216a UAAUCUCAGCUGGCAACUGUGA
ENSBTAT00000018232 MI0000826 hsa-miR-346 UGUCUGCCCGCAUGCCUGCCUCU
ENSBTAT00000018232 MI0002464 hsa-miR-412 ACUUCACCUGGUCCACUAGCCGU
ENSBTAT00000018232 MI0003160 hsa-miR-524-3p GAAGGCGCUUCCCUUUGGAGU
ENSBTAT00000018232 MI0003585 hsa-miR-578 CUUCUUGUGCUCUAGGAUUGU
ENSBTAT00000018232 MI0003588 hsa-miR-581 UCUUGUGUUCUCUAGAUCAGU
ENSBTAT00000018232 MI0003608 hsa-miR-596 AAGCCUGCCCGGCUCCUCGGG
ENSBTAT00000018232 MI0003611 hsa-miR-599 GUUGUGUCAGUUUAUCAAAC
ENSBTAT00000018232 MI0003647 hsa-miR-632 GUGUCUGCUUCCUGUGGGA
ENSBTAT00000018232 MI0003662 hsa-miR-647 GUGGCUGCACUCACUUCCUUC
ENSBTAT00000018232 MI0003676 hsa-miR-654-3p UAUGUCUGCUGACCAUCACCUU
ENSBTAT00000018232 MI0003681 hsa-miR-657 GGCAGGUUCUCACCCUCUCUAGG
ENSBTAT00000018232 MI0003683 hsa-miR-659 CUUGGUUCAGGGAGGGUCCCCA
ENSBTAT00000018232 MI0003836 hsa-miR-766 ACUCCAGCCCCACAGCCUCAGC
ENSBTAT00000018232 MI0005532 hsa-miR-874 CUGCCCUGGCCCGAGGGACCGA
ENSBTAT00000018232 MI0005562 hsa-miR-887 GUGAACGGGCGCCAUCCCGAGG
ENSBTAT00000018232 MI0005538 hsa-miR-892b CACUGGCUCCUUUCUGGGUAGA
ENSBTAT00000018232 MI0000391 mmu-miR-293 AGUGCCGCAGAGUUUGUAGUGU
ENSBTAT00000018232 MI0005546 mmu-miR-466d-5p UGUGUGUGCGUACAUGUACAUG
ENSBTAT00000018232 MI0005507 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENSBTAT00000018232 MI0005508 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENSBTAT00000018232 MI0005509 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENSBTAT00000018232 MI0005511 mmu-miR-466h UGUGUGCAUGUGCUUGUGUGUA
ENSBTAT00000018232 MI0004523 mmu-miR-669a AGUUGUGUGUGCAUGUUCAUGU
ENSBTAT00000018232 MI0004667 mmu-miR-669a AGUUGUGUGUGCAUGUUCAUGU
ENSBTAT00000018232 MI0004668 mmu-miR-669a AGUUGUGUGUGCAUGUUCAUGU
ENSBTAT00000018232 MI0004644 mmu-miR-682 CUGCAGUCACAGUGAAGUCUG
ENSBTAT00000018232 MI0004654 mmu-miR-689 CGUCCCCGCUCGGCGGGGUCC
ENSBTAT00000018232 MI0004655 mmu-miR-689 CGUCCCCGCUCGGCGGGGUCC
ENSBTAT00000018232 MI0004691 mmu-miR-707 CAGUCAUGCCGCUUGCCUACG
ENSBTAT00000018232 MI0004696 mmu-miR-712 CUCCUUCACCCGGGCGGUACC
ENSBTAT00000018232 MI0004700 mmu-miR-715 CUCCGUGCACACCCCCGCGUG
ENSBTAT00000018232 MI0004678 mmu-miR-720 AUCUCGCUGGGGCCUCCA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene