AATF | GeneID:786013 | Bos taurus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 786013 Official Symbol AATF
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description apoptosis antagonizing transcription factor
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 40811

ID Symbol Protein Species
GeneID:26574 AATF NP_036270.1 Homo sapiens
GeneID:33943 CG11188 NP_609066.1 Drosophila melanogaster
GeneID:56321 Aatf NP_062790.1 Mus musculus
GeneID:114512 Aatf NP_446172.1 Rattus norvegicus
GeneID:171723 Y73E7A.2 NP_490870.2 Caenorhabditis elegans
GeneID:417653 AATF NP_001025895.1 Gallus gallus
GeneID:454601 AATF XP_511427.2 Pan troglodytes
GeneID:480595 AATF XP_537715.2 Canis lupus familiaris
GeneID:559477 aatf NP_001077297.1 Danio rerio
GeneID:786013 AATF XP_001252958.1 Bos taurus
GeneID:836254 AT5G61330 NP_200941.2 Arabidopsis thaliana
GeneID:851893 BFR2 NP_010585.1 Saccharomyces cerevisiae
GeneID:1269788 AgaP_AGAP007394 XP_308438.2 Anopheles gambiae
GeneID:2543540 SPAC664.08c NP_593456.1 Schizosaccharomyces pombe
GeneID:2677840 MGG_04641 XP_362196.2 Magnaporthe grisea
GeneID:2706053 NCU04787.1 XP_324144.1 Neurospora crassa
GeneID:2892016 KLLA0C10362g XP_452661.1 Kluyveromyces lactis
GeneID:4323936 Os01g0526200 NP_001043227.1 Oryza sativa
GeneID:4618523 AGOS_AAL064W NP_982478.1 Eremothecium gossypii

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_001252957 XP_001252958

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSBTAT00000029234 MI0005023 bta-miR-545* UCAGUAAAUGUUUAUUGGAUG
ENSBTAT00000029234 MI0000450 hsa-miR-133a UUUGGUCCCCUUCAACCAGCUG
ENSBTAT00000029234 MI0000451 hsa-miR-133a UUUGGUCCCCUUCAACCAGCUG
ENSBTAT00000029234 MI0000822 hsa-miR-133b UUUGGUCCCCUUCAACCAGCUA
ENSBTAT00000029234 MI0000452 hsa-miR-135a UAUGGCUUUUUAUUCCUAUGUGA
ENSBTAT00000029234 MI0000453 hsa-miR-135a UAUGGCUUUUUAUUCCUAUGUGA
ENSBTAT00000029234 MI0000810 hsa-miR-135b UAUGGCUUUUCAUUCCUAUGUGA
ENSBTAT00000029234 MI0005544 hsa-miR-147b GUGUGCGGAAAUGCUUCUGCUA
ENSBTAT00000029234 MI0000482 hsa-miR-185 UGGAGAGAAAGGCAGUUCCUGA
ENSBTAT00000029234 MI0000781 hsa-miR-373 GAAGUGCUUCGAUUUUGGGGUGU
ENSBTAT00000029234 MI0001145 hsa-miR-384 AUUCCUAGAAAUUGUUCAUA
ENSBTAT00000029234 MI0003126 hsa-miR-491-5p AGUGGGGAACCCUUCCAUGAGG
ENSBTAT00000029234 MI0003188 hsa-miR-503 UAGCAGCGGGAACAGUUCUGCAG
ENSBTAT00000029234 MI0003180 hsa-miR-516a-3p UGCUUCCUUUCAGAGGGU
ENSBTAT00000029234 MI0003181 hsa-miR-516a-3p UGCUUCCUUUCAGAGGGU
ENSBTAT00000029234 MI0003164 hsa-miR-520d-3p AAAGUGCUUCUCUUUGGUGGGU
ENSBTAT00000029234 MI0003143 hsa-miR-520e AAAGUGCUUCCUUUUUGAGGG
ENSBTAT00000029234 MI0003570 hsa-miR-564 AGGCACGGUGUCAGCAGGC
ENSBTAT00000029234 MI0005542 hsa-miR-876-3p UGGUGGUUUACAAAGUAAUUCA
ENSBTAT00000029234 MI0005755 hsa-miR-933 UGUGCGCAGGGAGACCUCUCCC
ENSBTAT00000029234 MI0000389 mmu-miR-291a-3p AAAGUGCUUCCACUUUGUGUGC
ENSBTAT00000029234 MI0000392 mmu-miR-294 AAAGUGCUUCCCUUUUGUGUGU
ENSBTAT00000029234 MI0005511 mmu-miR-466h UGUGUGCAUGUGCUUGUGUGUA
ENSBTAT00000029234 MI0004686 mmu-miR-702 UGCCCACCCUUUACCCCGCUC
ENSBTAT00000029234 MI0004707 mmu-miR-718 CUUCCGCCCGGCCGGGUGUCG
ENSBTAT00000029234 MI0005472 mmu-miR-879 AGAGGCUUAUAGCUCUAAGCC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene