AASDHPPT | GeneID:784811 | Bos taurus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 784811 Official Symbol AASDHPPT
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 9130

ID Symbol Protein Species
GeneID:60496 AASDHPPT NP_056238.2 Homo sapiens
GeneID:67618 Aasdhppt NP_080552.2 Mus musculus
GeneID:180425 T04G9.4 NP_508153.1 Caenorhabditis elegans
GeneID:189061 T28H10.1 NP_506135.1 Caenorhabditis elegans
GeneID:300328 Aasdhppt XP_217078.3 Rattus norvegicus
GeneID:317852 eap NP_729788.1 Drosophila melanogaster
GeneID:418975 AASDHPPT XP_417169.2 Gallus gallus
GeneID:451524 AASDHPPT XP_508734.2 Pan troglodytes
GeneID:489426 AASDHPPT XP_546544.2 Canis lupus familiaris
GeneID:519816 AASDHPPT XP_869172.1 Bos taurus
GeneID:619247 zgc:114148 NP_001028901.1 Danio rerio
GeneID:784811 AASDHPPT XP_001250766.1 Bos taurus
GeneID:4349713 Os11g0136500 NP_001065690.1 Oryza sativa
GeneID:4351429 Os12g0133400 NP_001066088.1 Oryza sativa

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0008897 Function holo-[acyl-carrier-protein] synthase activity
GO:0000287 Function magnesium ion binding
GO:0009059 Process macromolecule biosynthetic process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_001250765 XP_001250766

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSBTAT00000040234 MI0005029 bta-miR-138 AGCUGGUGUUGUGAAUCAGGCCG
ENSBTAT00000040234 MI0004758 bta-miR-199a-5p CCCAGUGUUCAGACUACCUGUU
ENSBTAT00000040234 MI0005067 bta-miR-25 CAUUGCACUUGUCUCGGUCUGA
ENSBTAT00000040234 MI0004748 bta-miR-320 AAAAGCUGGGUUGAGAGGGCGA
ENSBTAT00000040234 MI0005465 bta-miR-365 UAAUGCCCCUAAAAAUCCUUAU
ENSBTAT00000040234 MI0005024 bta-miR-92 UAUUGCACUUGUCCCGGCCUGU
ENSBTAT00000040234 MI0000111 hsa-miR-105 UCAAAUGCUCAGACUCCUGUGGU
ENSBTAT00000040234 MI0000112 hsa-miR-105 UCAAAUGCUCAGACUCCUGUGGU
ENSBTAT00000040234 MI0000810 hsa-miR-135b UAUGGCUUUUCAUUCCUAUGUGA
ENSBTAT00000040234 MI0000086 hsa-miR-28-5p AAGGAGCUCACAGUCUAUUGAG
ENSBTAT00000040234 MI0000807 hsa-miR-323-3p CACAUUACACGGUCGACCUCU
ENSBTAT00000040234 MI0003686 hsa-miR-542-3p UGUGACAGAUUGAUAACUGAAA
ENSBTAT00000040234 MI0003604 hsa-miR-592 UUGUGUCAAUAUGCGAUGAUGU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]