ABCB6 | GeneID:783257 | Bos taurus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 783257 Official Symbol ABCB6
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description ATP-binding cassette, sub-family B (MDR/TAP), member 6
Chromosome N/A
Also Known As ATP-binding cassette, sub-family B, member 6
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 11375

ID Symbol Protein Species
GeneID:10058 ABCB6 NP_005680.1 Homo sapiens
GeneID:41925 CG4225 NP_650503.1 Drosophila melanogaster
GeneID:74104 Abcb6 NP_076221.1 Mus musculus
GeneID:140669 Abcb6 NP_542149.1 Rattus norvegicus
GeneID:176540 hmt-1 NP_001022812.1 Caenorhabditis elegans
GeneID:459959 ABCB6 XP_001161097.1 Pan troglodytes
GeneID:478914 ABCB6 XP_536073.2 Canis lupus familiaris
GeneID:564067 abcb6 XP_692515.3 Danio rerio
GeneID:783257 ABCB6 XP_001251072.1 Bos taurus
GeneID:812037 PF14_0455 XP_001348629.1 Plasmodium falciparum
GeneID:1269280 AgaP_AGAP002278 XP_307900.2 Anopheles gambiae
GeneID:2675723 MGG_05190 XP_359587.2 Magnaporthe grisea
GeneID:2704167 NCU00010.1 XP_322096.1 Neurospora crassa
GeneID:3361134 hmt1 NP_588371.2 Schizosaccharomyces pombe

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001098156 NP_001091625

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSBTAT00000027459 MI0005010 bta-miR-140 UACCACAGGGUAGAACCACGGA
ENSBTAT00000027459 MI0005011 bta-miR-142* AGUGUUUCCUACUUUAUGGAUG
ENSBTAT00000027459 MI0004742 bta-miR-21 UAGCUUAUCAGACUGAUGUUGACU
ENSBTAT00000027459 MI0004733 bta-miR-29a CUAGCACCAUCUGAAAUCGGUUA
ENSBTAT00000027459 MI0005043 bta-miR-29b UAGCACCAUUUGAAAUCAGUGUUU
ENSBTAT00000027459 MI0005044 bta-miR-29c UAGCACCAUUUGAAAUCGGUUA
ENSBTAT00000027459 MI0005059 bta-miR-342 UCUCACACAGAAAUCGCACCCAUCU
ENSBTAT00000027459 MI0005047 bta-miR-425-3p AUCGGGAAUGUCGUGUCCGCCC
ENSBTAT00000027459 MI0005047 bta-miR-425-5p AUGACACGAUCACUCCCGUUGA
ENSBTAT00000027459 MI0005049 bta-miR-455* GCAGUCCAUGGGCAUAUACACU
ENSBTAT00000027459 MI0000681 hsa-miR-155 UUAAUGCUAAUCGUGAUAGGGGU
ENSBTAT00000027459 MI0000484 hsa-miR-188-3p CUCCCACAUGCAGGGUUUGCA
ENSBTAT00000027459 MI0000807 hsa-miR-323-3p CACAUUACACGGUCGACCUCU
ENSBTAT00000027459 MI0000807 hsa-miR-323-5p AGGUGGUCCGUGGCGCGUUCGC
ENSBTAT00000027459 MI0000778 hsa-miR-370 GCCUGCUGGGGUGGAACCUGGU
ENSBTAT00000027459 MI0001729 hsa-miR-451 AAACCGUUACCAUUACUGAGUU
ENSBTAT00000027459 MI0003132 hsa-miR-493 UGAAGGUCUACUGUGUGCCAGG
ENSBTAT00000027459 MI0003134 hsa-miR-494 UGAAACAUACACGGGAAACCUC
ENSBTAT00000027459 MI0003185 hsa-miR-501-3p AAUGCACCCGGGCAAGGAUUCU
ENSBTAT00000027459 MI0003186 hsa-miR-502-3p AAUGCACCUGGGCAAGGAUUCA
ENSBTAT00000027459 MI0003562 hsa-miR-556-3p AUAUUACCAUUAGCUCAUCUUU
ENSBTAT00000027459 MI0003568 hsa-miR-562 AAAGUAGCUGUACCAUUUGC
ENSBTAT00000027459 MI0003583 hsa-miR-576-5p AUUCUAAUUUCUCCACGUCUUU
ENSBTAT00000027459 MI0003590 hsa-miR-583 CAAAGAGGAAGGUCCCAUUAC
ENSBTAT00000027459 MI0003597 hsa-miR-588 UUGGCCACAAUGGGUUAGAAC
ENSBTAT00000027459 MI0003626 hsa-miR-613 AGGAAUGUUCCUUCUUUGCC
ENSBTAT00000027459 MI0003635 hsa-miR-621 GGCUAGCAACAGCGCUUACCU
ENSBTAT00000027459 MI0003638 hsa-miR-624 CACAAGGUAUUGGUAUUACCU
ENSBTAT00000027459 MI0005564 hsa-miR-873 GCAGGAACUUGUGAGUCUCCU
ENSBTAT00000027459 MI0005560 hsa-miR-885-5p UCCAUUACACUACCCUGCCUCU
ENSBTAT00000027459 MI0000389 mmu-miR-291a-5p CAUCAAAGUGGAGGCCCUCUCU
ENSBTAT00000027459 MI0003539 mmu-miR-291b-5p GAUCAAAGUGGAGGCCCUCUCC
ENSBTAT00000027459 MI0002406 mmu-miR-471 UACGUAGUAUAGUGCUUUUCAC
ENSBTAT00000027459 MI0004634 mmu-miR-677 UUCAGUGAUGAUUAGCUUCUGA
ENSBTAT00000027459 MI0004646 mmu-miR-683 CCUGCUGUAAGCUGUGUCCUC
ENSBTAT00000027459 MI0004654 mmu-miR-689 CGUCCCCGCUCGGCGGGGUCC
ENSBTAT00000027459 MI0004655 mmu-miR-689 CGUCCCCGCUCGGCGGGGUCC
ENSBTAT00000027459 MI0004696 mmu-miR-712 CUCCUUCACCCGGGCGGUACC
ENSBTAT00000027459 MI0004310 mmu-miR-764-5p GGUGCUCACAUGUCCUCCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene