AAMP | GeneID:769880 | Gallus gallus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 769880 Official Symbol AAMP
Locus RCJMB04_5e2 Gene Type protein-coding
Synonyms
Full Name angio-associated, migratory cell protein
Description angio-associated, migratory cell protein
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 846

ID Symbol Protein Species
GeneID:14 AAMP NP_001078.2 Homo sapiens
GeneID:39624 CG5114 NP_648731.1 Drosophila melanogaster
GeneID:176680 Y111B2A.12 NP_499643.1 Caenorhabditis elegans
GeneID:227290 Aamp NP_666222.2 Mus musculus
GeneID:301512 Aamp XP_217441.4 Rattus norvegicus
GeneID:405874 zgc:85939 NP_998103.1 Danio rerio
GeneID:459940 AAMP XP_001154321.1 Pan troglodytes
GeneID:478908 AAMP NP_001013872.1 Canis lupus familiaris
GeneID:767919 AAMP NP_001070463.1 Bos taurus
GeneID:769880 AAMP XP_001233195.1 Gallus gallus
GeneID:843514 AT1G71840 NP_177329.2 Arabidopsis thaliana
GeneID:1268314 ENSANGG00000011272 XP_306869.2 Anopheles gambiae
GeneID:1278314 AgaP_AGAP011387 XP_317937.2 Anopheles gambiae
GeneID:2542715 SPAC25H1.08c NP_593812.1 Schizosaccharomyces pombe
GeneID:4333750 Os03g0685600 NP_001050927.1 Oryza sativa

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001079747 NP_001073215
2 XM_001233194 XP_001233195

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSGALT00000018663 MI0005048 bta-miR-450 UUUUGCGAUGUGUUCCUAAUAU
ENSGALT00000018663 MI0003587 hsa-miR-580 UUGAGAAUGAUGAAUCAUUAGG
ENSGALT00000018663 MI0003663 hsa-miR-648 AAGUGUGCAGGGCACUGGU
ENSGALT00000038174 MI0004749 bta-miR-484 UCAGGCUCAGUCCCCUCCCGAU
ENSGALT00000038174 MI0005060 bta-miR-487b AAUCGUACAGGGUCAUCCACUU
ENSGALT00000038174 MI0003695 gga-miR-146b* CCCUAUGGAUUCAGUUCUGC
ENSGALT00000038174 MI0000484 hsa-miR-188-5p CAUCCCUUGCAUGGUGGAGGG
ENSGALT00000038174 MI0005525 hsa-miR-300 UAUACAAGGGCAGACUCUCUCU
ENSGALT00000038174 MI0000803 hsa-miR-330-3p GCAAAGCACACGGCCUGCAGAGA
ENSGALT00000038174 MI0000815 hsa-miR-339-5p UCCCUGUCCUCCAGGAGCUCACG
ENSGALT00000038174 MI0001145 hsa-miR-384 AUUCCUAGAAAUUGUUCAUA
ENSGALT00000038174 MI0002467 hsa-miR-483-3p UCACUCCUCUCCUCCCGUCUU
ENSGALT00000038174 MI0002469 hsa-miR-485-3p GUCAUACACGGCUCUCCUCUCU
ENSGALT00000038174 MI0002470 hsa-miR-486-5p UCCUGUACUGAGCUGCCCCGAG
ENSGALT00000038174 MI0003140 hsa-miR-512-5p CACUCAGCCUUGAGGGCACUUUC
ENSGALT00000038174 MI0003141 hsa-miR-512-5p CACUCAGCCUUGAGGGCACUUUC
ENSGALT00000038174 MI0003156 hsa-miR-518b CAAAGCGCUCCCCUUUAGAGGU
ENSGALT00000038174 MI0003608 hsa-miR-596 AAGCCUGCCCGGCUCCUCGGG
ENSGALT00000038174 MI0003618 hsa-miR-605 UAAAUCCCAUGGUGCCUUCUCCU
ENSGALT00000038174 MI0003637 hsa-miR-623 AUCCCUUGCAGGGGCUGUUGGGU
ENSGALT00000038174 MI0003648 hsa-miR-633 CUAAUAGUAUCUACCACAAUAAA
ENSGALT00000038174 MI0003663 hsa-miR-648 AAGUGUGCAGGGCACUGGU
ENSGALT00000038174 MI0003682 hsa-miR-658 GGCGGAGGGAAGUAGGUCCGUUGGU
ENSGALT00000038174 MI0003834 hsa-miR-769-3p CUGGGAUCUCCGGGGUCUUGGUU
ENSGALT00000038174 MI0005760 hsa-miR-938 UGCCCUUAAAGGUGAACCCAGU
ENSGALT00000038174 MI0000098 hsa-miR-96 UUUGGCACUAGCACAUUUUUGCU
ENSGALT00000038174 MI0004215 mmu-miR-762 GGGGCUGGGGCCGGGACAGAGC
ENSGALT00000038174 MI0000635 rno-miR-347 UGUCCCUCUGGGUCGCCCA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Caldwell RB, et al. (2005) "Full-length cDNAs from chicken bursal lymphocytes to facilitate gene function analysis." Genome Biol. 6(1):R6. PMID:15642098