AADACL3 | GeneID:768668 | Gallus gallus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 768668 Official Symbol AADACL3
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description arylacetamide deacetylase-like 3
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 82530

ID Symbol Protein Species
GeneID:313688 RGD1565761 XP_233640.4 Rattus norvegicus
GeneID:343066 AADACL4 NP_001013652.1 Homo sapiens
GeneID:419479 AADACL4 XP_417635.2 Gallus gallus
GeneID:429936 LOC429936 XP_427491.2 Gallus gallus
GeneID:435815 OTTMUSG00000010747 NP_001074717.1 Mus musculus
GeneID:469815 AADACL4 XP_525200.2 Pan troglodytes
GeneID:569798 aadacl4 XP_698297.1 Danio rerio
GeneID:607688 AADACL4 XP_849554.1 Canis lupus familiaris
GeneID:768457 AADACL4 XP_001231394.1 Gallus gallus
GeneID:768489 LOC768489 XP_001231457.1 Gallus gallus
GeneID:768580 LOC768580 XP_001231604.1 Gallus gallus
GeneID:768597 LOC768597 XP_001231631.1 Gallus gallus
GeneID:768647 LOC768647 XP_001231701.1 Gallus gallus
GeneID:768668 AADACL3 XP_001231735.1 Gallus gallus

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016787 Function hydrolase activity
GO:0008152 Process metabolic process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_001231734 XP_001231735

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSGALT00000039475 MI0005048 bta-miR-450 UUUUGCGAUGUGUUCCUAAUAU
ENSGALT00000039475 MI0005468 bta-miR-660 UACCCAUUGCAUAUCGGAGCUG
ENSGALT00000039475 MI0001258 gga-miR-100 AACCCGUAGAUCCGAACUUGUG
ENSGALT00000039475 MI0003695 gga-miR-146b* CCCUAUGGAUUCAGUUCUGC
ENSGALT00000039475 MI0001173 gga-miR-99a AACCCGUAGAUCCGAUCUUGUG
ENSGALT00000039475 MI0003675 hsa-miR-411 UAGUAGACCGUAUAGCGUACG
ENSGALT00000039475 MI0003607 hsa-miR-595 GAAGUGUGCCGUGGUGUGUCU
ENSGALT00000039475 MI0005562 hsa-miR-887 GUGAACGGGCGCCAUCCCGAGG
ENSGALT00000039475 MI0003539 mmu-miR-291b-3p AAAGUGCAUCCAUUUUGUUUGU
ENSGALT00000039475 MI0004638 mmu-miR-679 GGACUGUGAGGUGACUCUUGGU
ENSGALT00000039475 MI0004677 mmu-miR-696 GCGUGUGCUUGCUGUGGG
ENSGALT00000039475 MI0005472 mmu-miR-879 AGAGGCUUAUAGCUCUAAGCC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]