ABHD12 | GeneID:768242 | Bos taurus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 768242 Official Symbol ABHD12
Locus N/A Gene Type protein-coding
Synonyms MGC140778
Full Name N/A
Description abhydrolase domain containing 12
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 22910

ID Symbol Protein Species
GeneID:26090 ABHD12 NP_001035937.1 Homo sapiens
GeneID:37200 CG15111 NP_611397.1 Drosophila melanogaster
GeneID:76192 Abhd12 NP_077785.1 Mus musculus
GeneID:179172 Y97E10AL.2 NP_505054.1 Caenorhabditis elegans
GeneID:421249 ABHD12 NP_001012889.1 Gallus gallus
GeneID:477004 ABHD12 XP_534202.2 Canis lupus familiaris
GeneID:499913 Abhd12 NP_001019485.1 Rattus norvegicus
GeneID:767657 abhd12 NP_001070065.1 Danio rerio
GeneID:768242 ABHD12 XP_001253369.1 Bos taurus
GeneID:1268858 ENSANGG00000010983 XP_307433.2 Anopheles gambiae
GeneID:1280498 ENSANGG00000011561 XP_320345.2 Anopheles gambiae

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0047372 Function acylglycerol lipase activity
GO:0016787 Function hydrolase activity

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001078116 NP_001071584

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSBTAT00000001863 MI0004759 bta-miR-205 UCCUUCAUUCCACCGGAGUCUG
ENSBTAT00000001863 MI0004744 bta-miR-222 AGCUACAUCUGGCUACUGGGU
ENSBTAT00000001863 MI0005046 bta-miR-423 AAGCUCGGUCUGAGGCCCCUCAGU
ENSBTAT00000001863 MI0005529 hsa-miR-220b CCACCACCGUGUCUGACACUU
ENSBTAT00000001863 MI0000826 hsa-miR-346 UGUCUGCCCGCAUGCCUGCCUCU
ENSBTAT00000001863 MI0002467 hsa-miR-483-3p UCACUCCUCUCCUCCCGUCUU
ENSBTAT00000001863 MI0002470 hsa-miR-486-3p CGGGGCAGCUCAGUACAGGAU
ENSBTAT00000001863 MI0002470 hsa-miR-486-5p UCCUGUACUGAGCUGCCCCGAG
ENSBTAT00000001863 MI0003188 hsa-miR-503 UAGCAGCGGGAACAGUUCUGCAG
ENSBTAT00000001863 MI0003596 hsa-miR-548b-3p CAAGAACCUCAGUUGCUUUUGU
ENSBTAT00000001863 MI0003592 hsa-miR-585 UGGGCGUAUCUGUAUGCUA
ENSBTAT00000001863 MI0003621 hsa-miR-608 AGGGGUGGUGUUGGGACAGCUCCGU
ENSBTAT00000001863 MI0003657 hsa-miR-642 GUCCCUCUCCAAAUGUGUCUUG
ENSBTAT00000001863 MI0003672 hsa-miR-663 AGGCGGGGCGCCGCGGGACCGC
ENSBTAT00000001863 MI0005528 hsa-miR-892a CACUGUGUCCUUUCUGCGUAG
ENSBTAT00000001863 MI0005762 hsa-miR-940 AAGGCAGGGCCCCCGCUCCCC
ENSBTAT00000001863 MI0004647 mmu-miR-684 AGUUUUCCCUUCAAGUCAA
ENSBTAT00000001863 MI0004648 mmu-miR-684 AGUUUUCCCUUCAAGUCAA
ENSBTAT00000001863 MI0004693 mmu-miR-709 GGAGGCAGAGGCAGGAGGA
ENSBTAT00000001863 MI0004699 mmu-miR-714 CGACGAGGGCCGGUCGGUCGC
ENSBTAT00000001863 MI0004700 mmu-miR-715 CUCCGUGCACACCCCCGCGUG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene