AAMP | GeneID:767919 | Bos taurus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 767919 Official Symbol AAMP
Locus N/A Gene Type protein-coding
Synonyms MGC127598
Full Name N/A
Description angio-associated, migratory cell protein
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 846

ID Symbol Protein Species
GeneID:14 AAMP NP_001078.2 Homo sapiens
GeneID:39624 CG5114 NP_648731.1 Drosophila melanogaster
GeneID:176680 Y111B2A.12 NP_499643.1 Caenorhabditis elegans
GeneID:227290 Aamp NP_666222.2 Mus musculus
GeneID:301512 Aamp XP_217441.4 Rattus norvegicus
GeneID:405874 zgc:85939 NP_998103.1 Danio rerio
GeneID:459940 AAMP XP_001154321.1 Pan troglodytes
GeneID:478908 AAMP NP_001013872.1 Canis lupus familiaris
GeneID:767919 AAMP NP_001070463.1 Bos taurus
GeneID:769880 AAMP XP_001233195.1 Gallus gallus
GeneID:843514 AT1G71840 NP_177329.2 Arabidopsis thaliana
GeneID:1268314 ENSANGG00000011272 XP_306869.2 Anopheles gambiae
GeneID:1278314 AgaP_AGAP011387 XP_317937.2 Anopheles gambiae
GeneID:2542715 SPAC25H1.08c NP_593812.1 Schizosaccharomyces pombe
GeneID:4333750 Os03g0685600 NP_001050927.1 Oryza sativa

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0009986 Component cell surface
GO:0005737 Component cytoplasm
GO:0005886 Component plasma membrane
GO:0030154 Process cell differentiation
GO:0007275 Process multicellular organismal development
GO:0045766 Process positive regulation of angiogenesis
GO:0010595 Process positive regulation of endothelial cell migration
GO:0014909 Process smooth muscle cell migration

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001076995 NP_001070463

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSBTAT00000005126 MI0005020 bta-miR-369-5p AUCGACCGUGUUAUAUUCGC
ENSBTAT00000005126 MI0005529 hsa-miR-220b CCACCACCGUGUCUGACACUU
ENSBTAT00000005126 MI0000300 hsa-miR-223 UGUCAGUUUGUCAAAUACCCCA
ENSBTAT00000005126 MI0005525 hsa-miR-300 UAUACAAGGGCAGACUCUCUCU
ENSBTAT00000005126 MI0000807 hsa-miR-323-5p AGGUGGUCCGUGGCGCGUUCGC
ENSBTAT00000005126 MI0001725 hsa-miR-329 AACACACCUGGUUAACCUCUUU
ENSBTAT00000005126 MI0001726 hsa-miR-329 AACACACCUGGUUAACCUCUUU
ENSBTAT00000005126 MI0000803 hsa-miR-330-3p GCAAAGCACACGGCCUGCAGAGA
ENSBTAT00000005126 MI0000762 hsa-miR-362-3p AACACACCUAUUCAAGGAUUCA
ENSBTAT00000005126 MI0000789 hsa-miR-381 UAUACAAGGGCAAGCUCUCUGU
ENSBTAT00000005126 MI0003153 hsa-miR-523 GAACGCGCUUCCCUAUAGAGGGU
ENSBTAT00000005126 MI0003616 hsa-miR-603 CACACACUGCAAUUACUUUUGC
ENSBTAT00000005126 MI0005715 hsa-miR-923 GUCAGCGGAGGAAAAGAAACU
ENSBTAT00000005126 MI0001526 mmu-miR-434-3p UUUGAACCAUCACUCGACUCCU
ENSBTAT00000005126 MI0005507 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENSBTAT00000005126 MI0005508 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENSBTAT00000005126 MI0005509 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENSBTAT00000005126 MI0005510 mmu-miR-466g AUACAGACACAUGCACACACA
ENSBTAT00000005126 MI0004646 mmu-miR-683 CCUGCUGUAAGCUGUGUCCUC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Beckner ME, et al. (2002) "Extracellular angio-associated migratory cell protein plays a positive role in angiogenesis and is regulated by astrocytes in coculture." Microvasc Res. 63(3):259-269. PMID:11969303