abhd12 | GeneID:767657 | Danio rerio

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 767657 Official Symbol abhd12
Locus N/A Gene Type protein-coding
Synonyms MGC153367; zgc:153367
Full Name abhydrolase domain containing 12
Description abhydrolase domain containing 12
Chromosome N/A
Also Known As
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 22910

ID Symbol Protein Species
GeneID:26090 ABHD12 NP_001035937.1 Homo sapiens
GeneID:37200 CG15111 NP_611397.1 Drosophila melanogaster
GeneID:76192 Abhd12 NP_077785.1 Mus musculus
GeneID:179172 Y97E10AL.2 NP_505054.1 Caenorhabditis elegans
GeneID:421249 ABHD12 NP_001012889.1 Gallus gallus
GeneID:477004 ABHD12 XP_534202.2 Canis lupus familiaris
GeneID:499913 Abhd12 NP_001019485.1 Rattus norvegicus
GeneID:767657 abhd12 NP_001070065.1 Danio rerio
GeneID:768242 ABHD12 XP_001253369.1 Bos taurus
GeneID:1268858 ENSANGG00000010983 XP_307433.2 Anopheles gambiae
GeneID:1280498 ENSANGG00000011561 XP_320345.2 Anopheles gambiae

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0016020 Component membrane
GO:0047372 Function acylglycerol lipase activity
GO:0016787 Function hydrolase activity
GO:0008150 Process biological_process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001076597 NP_001070065

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSDART00000104708 MI0001986 dre-miR-130b CAGUGCAAUAAUGAAAGGGCAU
ENSDART00000104708 MI0002015 dre-miR-148 UCAGUGCAUUACAGAACUUUGU
ENSDART00000104708 MI0002017 dre-miR-152 UCAGUGCAUGACAGAACUUUGG
ENSDART00000104708 MI0002023 dre-miR-155 UUAAUGCUAAUCGUGAUAGGGG
ENSDART00000104708 MI0001891 dre-miR-15a UAGCAGCACAGAAUGGUUUGUG
ENSDART00000104708 MI0001892 dre-miR-15a UAGCAGCACAGAAUGGUUUGUG
ENSDART00000104708 MI0001370 dre-miR-187 UCGUGUCUUGUGUUGCAGCC
ENSDART00000104708 MI0001378 dre-miR-205 UCCUUCAUUCCACCGGAGUCUG
ENSDART00000104708 MI0001907 dre-miR-20a* ACUGCAGUGUGAGCACUUGAAG
ENSDART00000104708 MI0001910 dre-miR-22a AAGCUGCCAGCUGAAGAACUGU
ENSDART00000104708 MI0001911 dre-miR-22a AAGCUGCCAGCUGAAGAACUGU
ENSDART00000104708 MI0001912 dre-miR-22b AAGCUGCCAGUUGAAGAGCUGU
ENSDART00000104708 MI0001913 dre-miR-23a AUCACAUUGCCAGGGAUUUCCA
ENSDART00000104708 MI0001915 dre-miR-23a AUCACAUUGCCAGGGAUUUCCA
ENSDART00000104708 MI0001916 dre-miR-23a AUCACAUUGCCAGGGAUUUCCA
ENSDART00000104708 MI0001917 dre-miR-23b AUCACAUUGCCAGGGAUUACCA
ENSDART00000104708 MI0001950 dre-miR-30e* CUUUCAGUCGGAUGUUUGCAGC
ENSDART00000104708 MI0003256 dre-miR-489 AGUGACAUCAUAUGUACGGCUGC
ENSDART00000104708 MI0004777 dre-miR-732 CUCAAAGCAGAGAACUCUCGGU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Steinke D, et al. (2006) "Many genes in fish have species-specific asymmetric rates of molecular evolution." BMC Genomics. 7():20. PMID:16466575
  2. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932