Abcc3 | GeneID:76408 | Mus musculus
Gene Summary
[
] NCBI Entrez Gene
| Gene ID | 76408 | Official Symbol | Abcc3 |
|---|---|---|---|
| Locus | RP23-65I14.2 | Gene Type | protein-coding |
| Synonyms | 1700019L09Rik; ABC31; MLP2; MOAT-D; MRP3 | ||
| Full Name | ATP-binding cassette, sub-family C (CFTR/MRP), member 3 | ||
| Description | ATP-binding cassette, sub-family C (CFTR/MRP), member 3 | ||
| Chromosome | 11 D | ||
| Also Known As | ATP-binding cassette protein C3; ATP-binding cassette transporter; OTTMUSP00000001838; multidrug resistance-associated protein 3; transporter | ||
| Summary | N/A | ||
Orthologs and Paralogs
[
] Homologs - NCBI's HomoloGene Group: 68364
| ID | Symbol | Protein | Species |
|---|---|---|---|
| GeneID:8714 | ABCC3 | NP_003777.2 | Homo sapiens |
| GeneID:76408 | Abcc3 | NP_083876.3 | Mus musculus |
| GeneID:140668 | Abcc3 | NP_542148.1 | Rattus norvegicus |
| GeneID:181202 | mrp-4 | NP_509658.1 | Caenorhabditis elegans |
| GeneID:422099 | ABCC3 | XP_420102.2 | Gallus gallus |
| GeneID:491084 | ABCC3 | XP_548204.2 | Canis lupus familiaris |
| GeneID:533151 | ABCC3 | XP_612461.3 | Bos taurus |
| GeneID:747938 | ABCC3 | XP_001158914.1 | Pan troglodytes |
| GeneID:839921 | ATMRP13 | NP_174330.1 | Arabidopsis thaliana |
| GeneID:839922 | ATMRP12 | NP_174331.2 | Arabidopsis thaliana |
Antibodies
[
] Monoclonal and Polyclonal Antibodies
| No. | Provider | Product No. | Description |
|---|---|---|---|
| 1 | sigma | M0318 | Anti-MRP3 antibody produced in rabbit ; |
Gene Classification
[
] Gene Ontology
| ID | Category | GO Term |
|---|---|---|
| GO:0016021 | Component | integral to membrane |
| GO:0005887 | Component | integral to plasma membrane |
| GO:0016020 | Component | membrane |
| GO:0016887 | Function | ATPase activity |
| GO:0042626 | Function | ATPase activity, coupled to transmembrane movement of substances |
| GO:0005524 | Function | ATP binding |
| GO:0017111 | Function | nucleoside-triphosphatase activity |
| GO:0000166 | Function | nucleotide binding |
| GO:0005215 | Function | transporter activity |
| GO:0015722 | Process | canalicular bile acid transport |
| GO:0006810 | Process | transport |
MicroRNA and Targets
[
] MicroRNA Sequences and Transcript Targets from miRBase at Sanger
| RNA Target | miRNA # | mat miRNA | Mature miRNA Sequence |
|---|---|---|---|
| ENSMUST00000021231 | MI0000240 | hsa-miR-198 | GGUCCAGAGGGGAGAUAGGUUC |
| ENSMUST00000021231 | MI0003133 | hsa-miR-432 | UCUUGGAGUAGGUCAUUGGGUGG |
| ENSMUST00000021231 | MI0003593 | hsa-miR-548a-3p | CAAAACUGGCAAUUACUUUUGC |
| ENSMUST00000021231 | MI0003598 | hsa-miR-548a-3p | CAAAACUGGCAAUUACUUUUGC |
| ENSMUST00000021231 | MI0003612 | hsa-miR-548a-3p | CAAAACUGGCAAUUACUUUUGC |
| ENSMUST00000021231 | MI0003569 | hsa-miR-563 | AGGUUGACAUACGUUUCCC |
| ENSMUST00000021231 | MI0003599 | hsa-miR-589 | UGAGAACCACGUCUGCUCUGAG |
| ENSMUST00000021231 | MI0003614 | hsa-miR-601 | UGGUCUAGGAUUGUUGGAGGAG |
| ENSMUST00000021231 | MI0003645 | hsa-miR-631 | AGACCUGGCCCAGACCUCAGC |
| ENSMUST00000021231 | MI0003653 | hsa-miR-638 | AGGGAUCGCGGGCGGGUGGCGGCCU |
| ENSMUST00000021231 | MI0003659 | hsa-miR-644 | AGUGUGGCUUUCUUAGAGC |
| ENSMUST00000021231 | MI0003683 | hsa-miR-659 | CUUGGUUCAGGGAGGGUCCCCA |
| ENSMUST00000021231 | MI0005116 | hsa-miR-765 | UGGAGGAGAAGGAAGGUGAUG |
| ENSMUST00000021231 | MI0005533 | hsa-miR-890 | UACUUGGAAAGGCAUCAGUUG |
| ENSMUST00000021231 | MI0005538 | hsa-miR-892b | CACUGGCUCCUUUCUGGGUAGA |
| ENSMUST00000021231 | MI0000138 | mmu-let-7i | UGAGGUAGUAGUUUGUGCUGUU |
| ENSMUST00000021231 | MI0000148 | mmu-miR-101a | UACAGUACUGUGAUAACUGAA |
| ENSMUST00000021231 | MI0000649 | mmu-miR-101b | UACAGUACUGUGAUAGCUGAA |
| ENSMUST00000021231 | MI0000587 | mmu-miR-103 | AGCAGCAUUGUACAGGGCUAUGA |
| ENSMUST00000021231 | MI0000588 | mmu-miR-103 | AGCAGCAUUGUACAGGGCUAUGA |
| ENSMUST00000021231 | MI0000684 | mmu-miR-107 | AGCAGCAUUGUACAGGGCUAUCA |
| ENSMUST00000021231 | MI0000169 | mmu-miR-145* | AUUCCUGGAAAUACUGUUCUUG |
| ENSMUST00000021231 | MI0000170 | mmu-miR-146a | UGAGAACUGAAUUCCAUGGGUU |
| ENSMUST00000021231 | MI0000171 | mmu-miR-149 | UCUGGCUCCGUGUCUUCACUCCC |
| ENSMUST00000021231 | MI0000174 | mmu-miR-152 | UCAGUGCAUGACAGAACUUGG |
| ENSMUST00000021231 | MI0000140 | mmu-miR-15b* | CGAAUCAUUAUUUGCUGCUCUA |
| ENSMUST00000021231 | MI0000687 | mmu-miR-17* | ACUGCAGUGAGGGCACUUGUAG |
| ENSMUST00000021231 | MI0000697 | mmu-miR-181a-1* | ACCAUCGACCGUUGAUUGUACC |
| ENSMUST00000021231 | MI0000224 | mmu-miR-182 | UUUGGCAAUGGUAGAACUCACACCG |
| ENSMUST00000021231 | MI0000551 | mmu-miR-192 | CUGACCUAUGAAUUGACAGCC |
| ENSMUST00000021231 | MI0000235 | mmu-miR-193 | AACUGGCCUACAAAGUCCCAGU |
| ENSMUST00000021231 | MI0005484 | mmu-miR-193b | AACUGGCCCACAAAGUCCCGCU |
| ENSMUST00000021231 | MI0000248 | mmu-miR-205 | UCCUUCAUUCCACCGGAGUCUG |
| ENSMUST00000021231 | MI0003536 | mmu-miR-20b* | ACUGCAGUGUGAGCACUUCUAG |
| ENSMUST00000021231 | MI0000974 | mmu-miR-215 | AUGACCUAUGAUUUGACAGAC |
| ENSMUST00000021231 | MI0000231 | mmu-miR-24 | UGGCUCAGUUCAGCAGGAACAG |
| ENSMUST00000021231 | MI0000572 | mmu-miR-24 | UGGCUCAGUUCAGCAGGAACAG |
| ENSMUST00000021231 | MI0000690 | mmu-miR-28* | CACUAGAUUGUGAGCUGCUGGA |
| ENSMUST00000021231 | MI0000576 | mmu-miR-29a | UAGCACCAUCUGAAAUCGGUUA |
| ENSMUST00000021231 | MI0000143 | mmu-miR-29b | UAGCACCAUUUGAAAUCAGUGUU |
| ENSMUST00000021231 | MI0000712 | mmu-miR-29b | UAGCACCAUUUGAAAUCAGUGUU |
| ENSMUST00000021231 | MI0000577 | mmu-miR-29c | UAGCACCAUUUGAAAUCGGUUA |
| ENSMUST00000021231 | MI0000704 | mmu-miR-320 | AAAAGCUGGGUUGAGAGGGCGA |
| ENSMUST00000021231 | MI0000630 | mmu-miR-344 | UGAUCUAGCCAAAGCCUGACUGU |
| ENSMUST00000021231 | MI0005495 | mmu-miR-344 | UGAUCUAGCCAAAGCCUGACUGU |
| ENSMUST00000021231 | MI0000763 | mmu-miR-362-5p | AAUCCUUGGAACCUAGGUGUGAAU |
| ENSMUST00000021231 | MI0000795 | mmu-miR-378 | ACUGGACUUGGAGUCAGAAGG |
| ENSMUST00000021231 | MI0001638 | mmu-miR-448 | UUGCAUAUGUAGGAUGUCCCAU |
| ENSMUST00000021231 | MI0004705 | mmu-miR-450b-5p | UUUUGCAGUAUGUUCCUGAAUA |
| ENSMUST00000021231 | MI0002405 | mmu-miR-470* | AACCAGUACCUUUCUGAGAAGA |
| ENSMUST00000021231 | MI0005516 | mmu-miR-509-3p | UGAUUGACAUUUCUGUAAUGG |
| ENSMUST00000021231 | MI0003518 | mmu-miR-540-3p | AGGUCAGAGGUCGAUCCUGG |
| ENSMUST00000021231 | MI0004131 | mmu-miR-551b | GCGACCCAUACUUGGUUUCAG |
| ENSMUST00000021231 | MI0006127 | mmu-miR-582-3p | CCUGUUGAACAACUGAACCCAA |
| ENSMUST00000021231 | MI0004171 | mmu-miR-665 | ACCAGGAGGCUGAGGUCCCU |
| ENSMUST00000021231 | MI0004638 | mmu-miR-679 | GGACUGUGAGGUGACUCUUGGU |
| ENSMUST00000021231 | MI0004654 | mmu-miR-689 | CGUCCCCGCUCGGCGGGGUCC |
| ENSMUST00000021231 | MI0004655 | mmu-miR-689 | CGUCCCCGCUCGGCGGGGUCC |
| ENSMUST00000021231 | MI0004687 | mmu-miR-703 | AAAACCUUCAGAAGGAAAGAA |
| ENSMUST00000021231 | MI0004692 | mmu-miR-708* | CAACUAGACUGUGAGCUUCUAG |
| ENSMUST00000021231 | MI0004693 | mmu-miR-709 | GGAGGCAGAGGCAGGAGGA |
| ENSMUST00000021231 | MI0004695 | mmu-miR-711 | GGGACCCGGGGAGAGAUGUAAG |
| ENSMUST00000021231 | MI0004704 | mmu-miR-717 | CUCAGACAGAGAUACCUUCUCU |
| ENSMUST00000021231 | MI0005471 | mmu-miR-871 | UAUUCAGAUUAGUGCCAGUCAUG |
| ENSMUST00000021231 | MI0005472 | mmu-miR-879* | GCUUAUGGCUUCAAGCUUUCGG |
| ENSMUST00000021231 | MI0005476 | mmu-miR-883a-3p | UAACUGCAACAGCUCUCAGUAU |
| ENSMUST00000021231 | MI0005477 | mmu-miR-883b-3p | UAACUGCAACAUCUCUCAGUAU |
| ENSMUST00000021231 | MI0003722 | rno-miR-664 | UAUUCAUUUACUCCCCAGCCUA |
| ENSMUST00000021231 | MI0003723 | rno-miR-664 | UAUUCAUUUACUCCCCAGCCUA |
Selected Publications
[
] Gene-related publications indexed at PubMed
- [
] Liu JJ, et al. (2008) "Cholangiocyte bile salt transporters in cholesterol gallstone-susceptible and resistant inbred mouse strains." J Gastroenterol Hepatol. 23(10):1596-1602. PMID:18717763 - [
] Rao A, et al. (2008) "The organic solute transporter alpha-beta, Ostalpha-Ostbeta, is essential for intestinal bile acid transport and homeostasis." Proc Natl Acad Sci U S A. 105(10):3891-3896. PMID:18292224 - [
] Vlaming ML, et al. (2008) "Impact of Abcc2 (Mrp2) and Abcc3 (Mrp3) on the in vivo elimination of methotrexate and its main toxic metabolite 7-hydroxymethotrexate." Clin Cancer Res. 14(24):8152-8160. PMID:19088030 - [
] Kruh GD, et al. (2007) "Physiological and pharmacological functions of Mrp2, Mrp3 and Mrp4 as determined from recent studies on gene-disrupted mice." Cancer Metastasis Rev. 26(1):5-14. PMID:17273943 - [
] van de Wetering K, et al. (2007) "Multidrug resistance proteins 2 and 3 provide alternative routes for hepatic excretion of morphine-glucuronides." Mol Pharmacol. 72(2):387-394. PMID:17485564 - [
] Fukumoto K, et al. (2007) "Effects of genetic backgrounds on hyperbilirubinemia in radixin-deficient mice due to different expression levels of Mrp3." Biochim Biophys Acta. 1772(3):298-306. PMID:17204408 - [
] Li Q, et al. (2007) "Targeted ablation of Abcc1 or Abcc3 in Abcc6(-/-) mice does not modify the ectopic mineralization process." Exp Dermatol. 16(10):853-859. PMID:17845218 - [
] Mazumdar M, et al. (2006) "Tumor formation via loss of a molecular motor protein." Curr Biol. 16(15):1559-1564. PMID:16890532 - [
] Zelcer N, et al. (2006) "Mice lacking Mrp3 (Abcc3) have normal bile salt transport, but altered hepatic transport of endogenous glucuronides." J Hepatol. 44(4):768-775. PMID:16225954 - [
] Sebastiani G, et al. (2006) "Mapping genetic modulators of amyloid plaque deposition in TgCRND8 transgenic mice." Hum Mol Genet. 15(15):2313-2323. PMID:16785251 - [
] Carninci P, et al. (2005) "The transcriptional landscape of the mammalian genome." Science. 309(5740):1559-1563. PMID:16141072 - [
] Maher JM, et al. (2005) "Tissue distribution and hepatic and renal ontogeny of the multidrug resistance-associated protein (Mrp) family in mice." Drug Metab Dispos. 33(7):947-955. PMID:15802388 - [
] Belinsky MG, et al. (2005) "Analysis of the in vivo functions of Mrp3." Mol Pharmacol. 68(1):160-168. PMID:15814571 - [
] McCarthy TC, et al. (2005) "Vitamin D receptor-dependent regulation of colon multidrug resistance-associated protein 3 gene expression by bile acids." J Biol Chem. 280(24):23232-23242. PMID:15824121 - [
] Zelcer N, et al. (2005) "Mice lacking multidrug resistance protein 3 show altered morphine pharmacokinetics and morphine-6-glucuronide antinociception." Proc Natl Acad Sci U S A. 102(20):7274-7279. PMID:15886284 - [
] Katayama S, et al. (2005) "Antisense transcription in the mammalian transcriptome." Science. 309(5740):1564-1566. PMID:16141073 - [
] Manautou JE, et al. (2005) "Altered disposition of acetaminophen in mice with a disruption of the Mrp3 gene." Hepatology. 42(5):1091-1098. PMID:16250050 - [
] Tanaka Y, et al. (2003) "Expressions of hepatobiliary organic anion transporters and bilirubin-conjugating enzyme in differentiating embryonic stem cells." Biochem Biophys Res Commun. 309(2):324-330. PMID:12951053 - [
] Bohan A, et al. (2003) "Tumor necrosis factor alpha-dependent up-regulation of Lrh-1 and Mrp3(Abcc3) reduces liver injury in obstructive cholestasis." J Biol Chem. 278(38):36688-36698. PMID:12837754 - [
] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932 - [
] Okazaki Y, et al. (2002) "Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs." Nature. 420(6915):563-573. PMID:12466851 - [
] Kawai J, et al. (2001) "Functional annotation of a full-length mouse cDNA collection." Nature. 409(6821):685-690. PMID:11217851 - [
] Ko MS, et al. (2000) "Large-scale cDNA analysis reveals phased gene expression patterns during preimplantation mouse development." Development. 127(8):1737-1749. PMID:10725249 - [
] Shibata K, et al. (2000) "RIKEN integrated sequence analysis (RISA) system--384-format sequencing pipeline with 384 multicapillary sequencer." Genome Res. 10(11):1757-1771. PMID:11076861 - [
] Carninci P, et al. (2000) "Normalization and subtraction of cap-trapper-selected cDNAs to prepare full-length cDNA libraries for rapid discovery of new genes." Genome Res. 10(10):1617-1630. PMID:11042159 - [
] Carninci P, et al. (1999) "High-efficiency full-length cDNA cloning." Methods Enzymol. 303():19-44. PMID:10349636
BACKGROUND AND AIM: We investigated the dietary and gender influences on the expression and functionality of cholangiocyte bile salt transporters and development of biliary hyperplasia in cholesterol gallstone-susceptible C57L/J and resistant AKR/J mice. METHODS: C57L and AKR mice were fed chow, a lithogenic diet, or a cholic acid-containing diet for 14 days. Expression of cholangiocyte bile salt transporter proteins ASBT (SLC10A2), ILBP (FABP6), and MRP3 (ABCC3) were studied by Western blot analysis. Taurocholate uptake studies were performed using microperfusion of isolated bile duct units. The pre- and post-perfusion taurocholate concentrations were analyzed by high performance liquid chromatography. Biliary proliferation in liver sections was scored. RESULTS: The lithogenic diet induced ductular proliferation in C57L mice. On chow, SLC10A2 and ABCC3 were overexpressed in male and female C57L compared to AKR mice. A lithogenic diet reduced the expressions of FABP6 in both male and female C57L mice, SLC10A2 in female C57L mice, and ABCC3 in male C57L mice. These alterations in transporter expressions were not associated with changes in taurocholate uptake. The lithogenic diet induced biliary hyperplasia and reduced bile salt transporter expressions in C57L mice. CONCLUSIONS: Although bile salt uptake was not increased in the bile duct unit, we speculate that the biliary hyperplasia on the lithogenic diet may lead to an increase in intrahepatic bile salt recycling during cholesterol cholelithogenesis.
The apical sodium-dependent bile acid transporter (Asbt) is responsible for transport across the intestinal brush border membrane; however, the carrier(s) responsible for basolateral bile acid export into the portal circulation remains to be determined. Although the heteromeric organic solute transporter Ostalpha-Ostbeta exhibits many properties predicted for a candidate intestinal basolateral bile acid transporter, the in vivo functions of Ostalpha-Ostbeta have not been investigated. To determine the role of Ostalpha-Ostbeta in intestinal bile acid absorption, the Ostalpha gene was disrupted by homologous recombination in mice. Ostalpha(-/-) mice were physically indistinguishable from wild-type mice. In everted gut sac experiments, transileal transport of taurocholate was reduced by >80% in Ostalpha(-/-) vs. wild-type mice; the residual taurocholate transport was further reduced to near-background levels in gut sacs prepared from Ostalpha(-/-)Mrp3(-/-) mice. The bile acid pool size was significantly reduced (>65%) in Ostalpha(-/-) mice, but fecal bile acid excretion was not elevated. The decreased pool size in Ostalpha(-/-) mice resulted from reduced hepatic Cyp7a1 expression that was inversely correlated with ileal expression of fibroblast growth factor 15 (FGF15). These data indicate that Ostalpha-Ostbeta is essential for intestinal bile acid transport in mice. Unlike a block in intestinal apical bile acid uptake, genetic ablation of basolateral bile acid export disrupts the classical homeostatic control of hepatic bile acid biosynthesis.
PURPOSE: ATP-binding cassette sub-family C member 2 [ABCC2; multidrug resistance-associated protein 2 (MRP2)] and ABCC3 (MRP3) mediate the elimination of toxic compounds, such as drugs and carcinogens, and have a large overlap in substrate specificity. We investigated the roles of Abcc2 and Abcc3 in the elimination of the anticancer drug methotrexate (MTX) and its toxic metabolite 7-hydroxymethotrexate (7OH-MTX) in vivo. EXPERIMENTAL DESIGN: Abcc2;Abcc3(-/-) mice were generated, characterized, and used to investigate possibly overlapping or complementary roles of Abcc2 and Abcc3 in the elimination of MTX and 7OH-MTX after i.v. administration of 50 mg/kg MTX. RESULTS: Abcc2;Abcc3(-/-) mice were viable and fertile. In Abcc2(-/-) mice, the plasma area under the curve (AUCi.v.) for MTX was 2.0-fold increased compared with wild type, leading to 1.6-fold increased urinary excretion, which was not seen in Abcc2;Abcc3(-/-) mice. Biliary excretion of MTX was 3.7-fold reduced in Abcc2(-/-) but unchanged in Abcc2;Abcc3(-/-) mice. The plasma AUCi.v.s of 7OH-MTX were 6.0-fold and 4.3-fold increased in Abcc2(-/-) and Abcc2;Abcc3(-/-) mice, respectively, leading to increased urinary excretion. The biliary excretion of 7OH-MTX was 5.8-fold reduced in Abcc2(-/-) but unchanged in Abcc2;Abcc3(-/-) mice. 7OH-MTX accumulated substantially in the liver of Abcc2(-/-) and especially Abcc2;Abcc3(-/-) mice. CONCLUSIONS: Abcc2 is important for (biliary) excretion of MTX and its toxic metabolite 7OH-MTX. When Abcc2 is absent, Abcc3 transports MTX and 7OH-MTX back from the liver into the circulation, leading to increased plasma levels and urinary excretion. Variation in ABCC2 and/or ABCC3 activity may therefore have profound effects on the elimination and severity of toxicity of MTX and 7OH-MTX after MTX treatment of patients.
The MRP family is composed of nine transporters, at least eight of which are lipophilic anion transporters that are capable of conferring resistance to various anticancer agents. Recently, mice with gene disruptions in Mrp2, Mrp3 and Mrp4 have been developed. This review will discuss insights into the physiological and pharmacological functions of Mrp2, Mrp3 and Mrp4 afforded by investigations of these new mouse models.
Glucuronidation is a major hepatic detoxification pathway for endogenous and exogenous compounds, resulting in the intracellular formation of polar metabolites that require specialized transporters for elimination. Multidrug resistance proteins (MRPs) are expressed in the liver and can transport glucuronosyl-conjugates. Using morphine as a model aglycone, we demonstrate that morphine-3-glucuronide (M3G), the predominant metabolite, is transported in vitro by human MRP2 (ABCC2), a protein present in the apical membrane of hepatocytes. Loss of biliary M3G secretion in Mrp2(-/-) mice results in its increased sinusoidal transport that can be attributed to Mrp3. Combined loss of Mrp2 and Mrp3 leads to a substantial accumulation of M3G in the liver, from which it is transported across the sinusoidal membrane at a low rate, resulting in the prolonged presence of M3G in plasma. Our results show that murine Mrp2 and Mrp3 provide alternative routes for the excretion of a glucuronidated substrate from the liver in vivo.
ERM (ezrin/radixin/moesin) proteins are organizers of apical actin cortical layer in general. We previously reported that the knockout of radixin resulted in Rdx(-/-) mice with displacement/loss of the canalicular transporter Mrp2, giving rise to Dubin-Johnson syndrome-like conjugated hyperbilirubinemia in the mixed genetic background (C57BL/6-129/Sv) (Kikuchi, et al. (2002) Nature Genetics 31, 320-325). However, when these mice were kept under mixed genetic background for years (late mixed backgrounds; LMB), the conjugated hyperbilirubinemia gradually became inconspicuous, while evidence of liver injury increased. We examined the effect of genetic background by backcrossing LMB Rdx(-/-) mice to C57BL/6 and 129/Sv wild type mice with the result that the Rdx(-/-) congenic mice regained hyperbilirubinemia with reduced hepatocellular damage. As revealed by immunofluorescence and western blots, the localization/expression of apical transporters, Mrp2, CD26, P-gps, and Bsep were not influenced by backcrossing, though those of a basolateral transporter, Mrp3, were strikingly increased by backcrossing.
Pseudoxanthoma elasticum (PXE) is a heritable disorder characterized by ectopic mineralization of connective tissues, with considerable intra- and interfamiliar phenotypic variability. PXE is caused by mutations in the ABCC6 gene, which encodes a transporter protein, MRP6, and targeted ablation of Abcc6 in mice recapitulates the manifestations of PXE. In this study, we examined the hypothesis that the expression of other members of the Abcc family may be altered in Abcc6 null mice, possibly explaining the phenotypic variability because of the functional overlap of these transporters. Analysis of the transcript levels of Abcc1-10 and 12 in the liver of Abcc6 (-/-) mice by quantitative RT-PCR indicated that the levels of other C family mRNAs were not significantly different from wild-type mice. Next, we developed Abcc6/1(-/-) and Abcc6/3(-/-) double null mice and examined them for tissue mineralization. Histopathologic examination, coupled with computerized morphometric analysis, and chemical assay of calcium x phosphate product in the muzzle skin of Abcc1(-/-) and Abcc3(-/-) mice did not reveal evidence of mineralization. Abcc6/1(-/-) and Abcc6/3(-/-) double knock-out mice exhibited connective tissue mineralization similar to that in Abcc6 (-/-) mice. These results emphasize the importance of the Abcc6 gene in the ectopic mineralization process and further suggest that other members of the Abcc family, particularly Abcc1 and Abcc3, do not modulate the effects of Abcc6 in this mouse model.
Aneuploidy has long been suggested to be causal in tumor formation. Direct testing of this hypothesis has been difficult because of the absence of methods to specifically induce aneuploidy. The chromosome-associated kinesin motor KIF4 plays multiple roles in mitosis, and its loss leads to multiple mitotic defects including aneuploidy. Here, we have taken advantage of the direct formation of aneuploidy in the absence of KIF4 to determine whether loss of a molecular motor and generation of aneuploidy during mitosis can trigger tumorigenesis. We find that embryonic stem cells genetically depleted of KIF4 support anchorage-independent growth and form tumors in nude mice. In cells lacking KIF4, mitotic spindle checkpoints and DNA-damage response pathways are activated. Down regulation or loss of KIF4 is physiologically relevant because reduced KIF4 levels are present in 35% of human cancers from several tissues. Our results support the notion that loss of a molecular motor leads to tumor formation and that aneuploidy can act as a primary trigger of tumorigenesis.
BACKGROUND/AIM: Multidrug Resistance Protein 3 (MRP3) transports bile salts and glucuronide conjugates in vitro and is postulated to protect the liver in cholestasis. Whether the absence of Mrp3 affects these processes in vivo is tested. METHODS: Mrp3-deficient mice were generated and the contribution of Mrp3 to bile salt and glucuronide conjugate transport was tested in (1): an Ussing-chamber set-up with ileal explants (2), the liver during bile-duct ligation (3), liver perfusion experiments, and (4) in vitro vesicular uptake experiments. RESULTS: The Mrp3((-/-)) mice show no overt phenotype. No differences between WT and Mrp3-deficient mice were found in the trans-ileal transport of taurocholate. After bile-duct ligation, there were no differences in histological liver damage and serum bile salt levels between Mrp3((-/-)) and WT mice, but Mrp3-deficient mice had lower serum bilirubin glucuronide concentrations. Glucuronide conjugates of hyocholate and hyodeoxycholate are substrates of MRP3 in vitro and in livers that lack Mrp3, there is reduced sinusoidal secretion of hyodeoxycholate-glucuronide after perfusion with hyodeoxycholate. CONCLUSIONS: Mrp3 does not have a major role in bile salt physiology, but is involved in the transport of glucuronidated compounds, which could include glucuronidated bile salts in humans.
Alzheimer's disease (AD) is a complex disorder for which various in vivo models exist. The TgCRND8 mouse, transgenic for the human amyloid precursor protein, is an aggressive early onset model of brain amyloid deposition. Preliminary studies revealed that when the transgene is expressed on an A/J genetic background, these mice not only survive longer but also deposit less parenchymal amyloid-beta (Abeta) peptides as compared to those on a C57BL/6 background. We performed a genome-wide study of an F2 intercross between TgCRND8 on an A/J background and C57BL/6 mice, to identify genetic modulators of amyloid accumulation and deposition. We identified four highly significant QTLs that together account for 55% of the phenotypic variance in the number of plaques (Thioflavin S). QTLs were found on the distal part of chromosome 4 with an LOD score of 8.1 at D4Mit251, on chromosome 11 with an LOD score of 5.5 at D11Mit242, on chromosome 9 with an LOD score of 5.0 at D9Mit336 and on the proximal part of chromosome 8 with an LOD score of 4.5 at D8Mit223. A/J alleles at these loci are protective and all decreased the amount of Abeta deposition. Interestingly, the QTL on chromosome 11 is also significantly linked to the levels of brain Abeta(42) and Abeta(40). Although these QTLs do not control the levels of plasmatic Abeta, other regions on chromosomes 1 and 6 show significant linkage. Further characterization of these QTL regions may lead to the identification of genes involved in the pathogenesis of AD.
This study describes comprehensive polling of transcription start and termination sites and analysis of previously unidentified full-length complementary DNAs derived from the mouse genome. We identify the 5' and 3' boundaries of 181,047 transcripts with extensive variation in transcripts arising from alternative promoter usage, splicing, and polyadenylation. There are 16,247 new mouse protein-coding transcripts, including 5154 encoding previously unidentified proteins. Genomic mapping of the transcriptome reveals transcriptional forests, with overlapping transcription on both strands, separated by deserts in which few transcripts are observed. The data provide a comprehensive platform for the comparative analysis of mammalian transcriptional regulation in differentiation and development.
Analysis of the mouse genome has revealed eight multidrug resistance-associated (Mrp) transporters, with mouse homologs for all human MRPs except MRP8. Whereas MRP expression in tissues of humans and rats has been examined, no characterization exists for mice. Furthermore, the ontogeny of mouse Mrps is unknown, and such knowledge may be helpful in understanding age-related pharmacokinetics. Therefore, the purpose of this study was to quantitatively determine 1) expression of the Mrp family in 12 different tissues, 2) gender variations in Mrp expression in liver and kidney, and 3) whether Mrp expression is altered during development. Highest expression of the Mrp family members is as follows: Mrp1 in testes, ovary, and placenta; Mrp2 in intestine, followed by liver and kidney; Mrp3 in large intestine; Mrp4 in kidney; Mrp5 in brain, followed by lung and stomach; Mrp6 in liver; Mrp7 in testes, intestine, and kidney; and Mrp9 solely in testes. Gender differences in Mrp expression were observed: Mrp1, 3, and 4 in kidney, as well as Mrp1 and 4 in liver were female-predominant. Ontogeny of the four Mrps expressed in liver was as follows: Mrp2 and Mrp4 were expressed at adult levels at birth; Mrp3 reached adult levels at day 30, and Mrp6 was not expressed until day 10. In kidney, Mrp1 and Mrp5 were expressed at adult levels at birth, whereas Mrp2, 3, 4, and 6 generally increased over time. In conclusion, marked differences in expression of the individual Mrp family members exist in various tissues, with age, and with gender.
Multidrug resistance protein 3 (MRP3) is an ATP-binding cassette transporter that is able to confer resistance to anticancer agents such as etoposide and to transport lipophilic anions such as bile acids and glucuronides. These capabilities, along with the induction of the MRP3 protein on hepatocyte sinusoidal membranes in cholestasis and the expression of MRP3 in enterocytes, have led to the hypotheses that MRP3 may function in the body to protect normal tissues from etoposide, to protect cholestatic hepatocytes from endobiotics, and to facilitate bile-acid reclamation from the gut. To elucidate the role of Mrp3 in these processes, the Mrp3 gene (Abcc3) was disrupted by homologous recombination. Homozygous null animals were healthy and physically indistinguishable from wild-type mice. Mrp3(-/-) mice did not exhibit enhanced lethality to etoposide phosphate, although an analysis of transfected human embryonic kidney 293 cells indicated that the potency of murine Mrp3 toward etoposide ( approximately 2.0- to 2.5-fold) is comparable with that of human MRP3. After induction of cholestasis by bile duct ligation, Mrp3(-/-) mice had 1.5-fold higher levels of liver bile acids and 3.1-fold lower levels of serum bilirubin glucuronide compared with ligated wild-type mice, whereas significant differences were not observed between the respective sham-operated mice. Bile acid excretion, pool size, and fractional turnover rates were similar in Mrp3(-/-) and wild-type mice. We conclude that Mrp3 functions as an alternative route for the export of bile acids and glucuronides from cholestatic hepatocytes, that the pump does not play a major role in the enterohepatic circulation of bile acids and that the lack of chemosensitivity is probably attributable to functional redundancy with other pumps.
The multidrug resistance-associated protein 3 (MRP3) is a multispecific anion transporter that is capable of transporting a number of conjugated and unconjugated bile acids. Expression of the MRP3 gene is increased during pathological states associated with elevated bile acid concentrations indicating a role for this transporter in adaptive and homeostatic bile acid metabolism. Analysis of Mrp3 mRNA levels in various mouse tissues with known relevance and/or exposure to bile acids revealed the highest levels of basal expression in the colon followed in order by the liver, duodenum, jejunum, ileum, and kidney. Functional analysis of a murine Mrp3 promoter reporter construct revealed vitamin D receptor (VDR)-dependent activation by 1,25-dihydroxyvitamin D(3) (VD3), 9-cis-retinoic acid (RA), and the cholestatic secondary bile acid, lithocholic acid (LCA). Using a series of deletion constructs combined with sequence analysis, a candidate VDR response element (VDRE) was identified between -1028 and -1014 bp of the Mrp3 promoter. Activation of the Mrp3 promoter in response to VD3, RA, or LCA, as well as binding of VDR/RXR heterodimers, was attenuated substantially by mutation of this VDRE. Treatment of mice with VD3 or LCA demonstrated in vivo modulation of the Mrp3 gene in colon but not in the liver. Reduction of endogenous VDR expression in colon adenocarcinoma MCA-38 cells by siRNA transfection was associated with reduced constitutive and inducible expression of the Mrp3 gene. These data support a regulatory role for the VDR in the protection of colon cells from bile acid toxicity through regulation of the Mrp3 expression.
Glucuronidation is a major detoxification pathway for endogenous and exogenous compounds in mammals that results in the intracellular formation of polar metabolites, requiring specialized transporters to cross biological membranes. By using morphine as a model aglycone, we demonstrate that multidrug resistance protein 3 (MRP3/ABCC3), a protein present in the basolateral membrane of polarized cells, transports morphine-3-glucuronide (M3G) and morphine-6-glucuronide in vitro. Mrp3(-/-) mice are unable to excrete M3G from the liver into the bloodstream, the major hepatic elimination route for this drug. This results in increased levels of M3G in liver and bile, a 50-fold reduction in the plasma levels of M3G, and in a major shift in the main disposition route for morphine and M3G, predominantly via the urine in WT mice but via the feces in Mrp3(-/-) mice. The pharamacokinetics of injected morphine-glucuronides are altered as well in the absence of Mrp3, and this results in a decreased antinociceptive potency of injected morphine-6-glucuronide.
Antisense transcription (transcription from the opposite strand to a protein-coding or sense strand) has been ascribed roles in gene regulation involving degradation of the corresponding sense transcripts (RNA interference), as well as gene silencing at the chromatin level. Global transcriptome analysis provides evidence that a large proportion of the genome can produce transcripts from both strands, and that antisense transcripts commonly link neighboring "genes" in complex loci into chains of linked transcriptional units. Expression profiling reveals frequent concordant regulation of sense/antisense pairs. We present experimental evidence that perturbation of an antisense RNA can alter the expression of sense messenger RNAs, suggesting that antisense transcription contributes to control of transcriptional outputs in mammals.
MRP3 is an ABC transporter localized in the basolateral membrane of epithelial cells such as hepatocytes and enterocytes. In this study, the role of Mrp3 in drug disposition was investigated. Because Mrp3 preferentially transports glucuronide conjugates, we investigated the in vivo disposition of acetaminophen (APAP) and its metabolites. Mrp3+/+ and Mrp3-/- knockout mice received APAP (150 mg/kg), and bile was collected. Basolateral and canalicular excretion of APAP was also assessed in the isolated perfused liver. In separate studies, mice received 400 mg APAP/kg for assessment of hepatotoxicity. No differences were found in the biliary excretion of APAP, APAP-sulfate, and APAP-glutathione between Mrp3+/+ and Mrp3-/- mice. However, 20-fold higher accumulation of APAP-glucuronide (APAP-GLUC) was found in the liver of Mrp3-/- mice. Concomitantly, plasma APAP-GLUC content in Mrp3-/- mice was less than 10% of that in Mrp3+/+ mice. In addition, APAP-GLUC excretion in bile of Mrp3-/- mice was tenfold higher than in Mrp3+/+ mice. In the isolated perfused liver, we also found a strong decrease of APAP-GLUC secretion into the perfusate of Mrp3-/- livers. Plasma alanine aminotransferase (ALT), aspartate aminotransferase (AST), and histopathology showed that Mrp3-/- mice are more resistant to APAP hepatotoxicity than Mrp3+/+ mice, which is most likely a result of the faster repletion of hepatic GSH. In conclusion, basolateral excretion of APAP-GLUC in mice is nearly completely dependent on the function of Mrp3. In its absence, sufficient hepatic accumulation occurs to redirect some of the APAP-GLUC to bile. This altered disposition in Mrp3-/- mice is associated with reduced hepatotoxicity.
Mouse embryonic stem (ES) cells are clonal cell lines derived from the inner cell mass of developing blastocysts and have multi-lineage differentiation ability. We previously reported that ES cells can be made to differentiate into hepatocytes possessing high metabolic activities by transfection of hepatocyte nuclear factor-3beta (HNF-3beta). In the present study, we investigated the expression of hepatobiliary organic anion transporters and bilirubin uridine diphosphate glucuronosyltransferase (ugt1a1) in undifferentiated and differentiating HNF-3beta-transfected ES (HNF-3beta-ES) cells. The expression of organic anion transporting polypeptide 1 (oatp1), multidrug resistance-associated protein 1 (mrp1), mrp2, mrp3, and ugt1a1 was not seen in the undifferentiated HNF-3beta-ES cells by RT-PCR, whereas all were expressed in differentiating HNF-3beta-ES cells. Protein expression for oatp1, mrp1, mrp2, mrp3, and ugt1a1 was also observed in the differentiating HNF-3beta-ES cells by Western blotting. An immunofluorescence examination revealed that oatp1 was co-located with desmoplakin, a marker for the basolateral (sinusoidal) membrane, and mrp2 was co-localized with CD26, a marker for the apical (canalicular) membrane, though they were both expressed throughout most of the cell membranes.
Mrp3(Abcc3) is markedly induced following bile duct ligation (BDL) in the rat and in some human cholestatic liver diseases and is believed to ameliorate liver injury in this setting. Recently, the orphan nuclear receptor fetoprotein transcription factor/cholesterol-7alpha-hydroxylase promoter factor (CPF/FTF/Lrh-1) has been shown to activate Mrp3 expression. However, whether inflammatory cytokines or elevated bile acid levels increased Lrh-1/Mrp3 expression in obstructive cholestasis was not known. We hypothesized that induction of Mrp3 would be associated with Lrh-1 up-regulation and would require intact cytokine signaling. Male tumor necrosis factor (Tnf) receptor I (Tnfr-/-) mice and C57BLJ wild type (WT) controls were subjected to sham surgery or bile duct ligation. HepG2 cells were treated with bile acids or cytokines. Immunoblot assay and real time reverse transcriptase-PCR were used to determine expression of MRP3/Mrp3, CPF/Lrh-1, Mrp2, and Bsep. CPF/Lrh-1 DNA binding to the MRP3/Mrp3 promoter was assessed using electrophoretic mobility shift assay, and promoter activity was determined by luciferase assay. Total bile acids and lactate dehydrogenase were measured using colorimetric assays, and cytokine abundance was determined by enzyme-linked immunosorbent assay. Lrh-1 and Mrp3 were significantly induced after BDL in WT but not Tnfr-/- mice. This was associated with more severe hepatocellular necrosis in Tnfr-/- mice. Lrh-1 binding to the Mrp3 promoter increased after BDL in WT but not in Tnfr-/- mice. Tnfalpha treatment of HepG2 cells also up-regulated CPF and MRP3, increased CPF binding to the MRP3 promoter, and up-regulated MRP3 promoter activity. These results indicate that induction of Mrp3 after BDL is due to Tnfalpha-dependent up-regulation of Lrh-1. They provide strong evidence that induction of Mrp3 plays a significant role in hepatocyte protection during obstructive cholestasis.
The National Institutes of Health Mammalian Gene Collection (MGC) Program is a multiinstitutional effort to identify and sequence a cDNA clone containing a complete ORF for each human and mouse gene. ESTs were generated from libraries enriched for full-length cDNAs and analyzed to identify candidate full-ORF clones, which then were sequenced to high accuracy. The MGC has currently sequenced and verified the full ORF for a nonredundant set of >9,000 human and >6,000 mouse genes. Candidate full-ORF clones for an additional 7,800 human and 3,500 mouse genes also have been identified. All MGC sequences and clones are available without restriction through public databases and clone distribution networks (see http:mgc.nci.nih.gov).
Only a small proportion of the mouse genome is transcribed into mature messenger RNA transcripts. There is an international collaborative effort to identify all full-length mRNA transcripts from the mouse, and to ensure that each is represented in a physical collection of clones. Here we report the manual annotation of 60,770 full-length mouse complementary DNA sequences. These are clustered into 33,409 'transcriptional units', contributing 90.1% of a newly established mouse transcriptome database. Of these transcriptional units, 4,258 are new protein-coding and 11,665 are new non-coding messages, indicating that non-coding RNA is a major component of the transcriptome. 41% of all transcriptional units showed evidence of alternative splicing. In protein-coding transcripts, 79% of splice variations altered the protein product. Whole-transcriptome analyses resulted in the identification of 2,431 sense-antisense pairs. The present work, completely supported by physical clones, provides the most comprehensive survey of a mammalian transcriptome so far, and is a valuable resource for functional genomics.
The RIKEN Mouse Gene Encyclopaedia Project, a systematic approach to determining the full coding potential of the mouse genome, involves collection and sequencing of full-length complementary DNAs and physical mapping of the corresponding genes to the mouse genome. We organized an international functional annotation meeting (FANTOM) to annotate the first 21,076 cDNAs to be analysed in this project. Here we describe the first RIKEN clone collection, which is one of the largest described for any organism. Analysis of these cDNAs extends known gene families and identifies new ones.
Little is known about gene action in the preimplantation events that initiate mammalian development. Based on cDNA collections made from each stage from egg to blastocyst, 25438 3'-ESTs were derived, and represent 9718 genes, half of them novel. Thus, a considerable fraction of mammalian genes is dedicated to embryonic expression. This study reveals profound changes in gene expression that include the transient induction of transcripts at each stage. These results raise the possibility that development is driven by the action of a series of stage-specific expressed genes. The new genes, 798 of them placed on the mouse genetic map, provide entry points for analyses of human and mouse developmental disorders.
The RIKEN high-throughput 384-format sequencing pipeline (RISA system) including a 384-multicapillary sequencer (the so-called RISA sequencer) was developed for the RIKEN mouse encyclopedia project. The RISA system consists of colony picking, template preparation, sequencing reaction, and the sequencing process. A novel high-throughput 384-format capillary sequencer system (RISA sequencer system) was developed for the sequencing process. This system consists of a 384-multicapillary auto sequencer (RISA sequencer), a 384-multicapillary array assembler (CAS), and a 384-multicapillary casting device. The RISA sequencer can simultaneously analyze 384 independent sequencing products. The optical system is a scanning system chosen after careful comparison with an image detection system for the simultaneous detection of the 384-capillary array. This scanning system can be used with any fluorescent-labeled sequencing reaction (chain termination reaction), including transcriptional sequencing based on RNA polymerase, which was originally developed by us, and cycle sequencing based on thermostable DNA polymerase. For long-read sequencing, 380 out of 384 sequences (99.2%) were successfully analyzed and the average read length, with more than 99% accuracy, was 654.4 bp. A single RISA sequencer can analyze 216 kb with >99% accuracy in 2.7 h (90 kb/h). For short-read sequencing to cluster the 3' end and 5' end sequencing by reading 350 bp, 384 samples can be analyzed in 1.5 h. We have also developed a RISA inoculator, RISA filtrator and densitometer, RISA plasmid preparator which can handle throughput of 40,000 samples in 17.5 h, and a high-throughput RISA thermal cycler which has four 384-well sites. The combination of these technologies allowed us to construct the RISA system consisting of 16 RISA sequencers, which can process 50,000 DNA samples per day. One haploid genome shotgun sequence of a higher organism, such as human, mouse, rat, domestic animals, and plants, can be revealed by seven RISA systems within one month.
In the effort to prepare the mouse full-length cDNA encyclopedia, we previously developed several techniques to prepare and select full-length cDNAs. To increase the number of different cDNAs, we introduce here a strategy to prepare normalized and subtracted cDNA libraries in a single step. The method is based on hybridization of the first-strand, full-length cDNA with several RNA drivers, including starting mRNA as the normalizing driver and run-off transcripts from minilibraries containing highly expressed genes, rearrayed clones, and previously sequenced cDNAs as subtracting drivers. Our method keeps the proportion of full-length cDNAs in the subtracted/normalized library high. Moreover, our method dramatically enhances the discovery of new genes as compared to results obtained by using standard, full-length cDNA libraries. This procedure can be extended to the preparation of full-length cDNA encyclopedias from other organisms.