Abcc3 | GeneID:76408 | Mus musculus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 76408 Official Symbol Abcc3
Locus RP23-65I14.2 Gene Type protein-coding
Synonyms 1700019L09Rik; ABC31; MLP2; MOAT-D; MRP3
Full Name ATP-binding cassette, sub-family C (CFTR/MRP), member 3
Description ATP-binding cassette, sub-family C (CFTR/MRP), member 3
Chromosome 11 D
Also Known As ATP-binding cassette protein C3; ATP-binding cassette transporter; OTTMUSP00000001838; multidrug resistance-associated protein 3; transporter
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 68364

ID Symbol Protein Species
GeneID:8714 ABCC3 NP_003777.2 Homo sapiens
GeneID:76408 Abcc3 NP_083876.3 Mus musculus
GeneID:140668 Abcc3 NP_542148.1 Rattus norvegicus
GeneID:181202 mrp-4 NP_509658.1 Caenorhabditis elegans
GeneID:422099 ABCC3 XP_420102.2 Gallus gallus
GeneID:491084 ABCC3 XP_548204.2 Canis lupus familiaris
GeneID:533151 ABCC3 XP_612461.3 Bos taurus
GeneID:747938 ABCC3 XP_001158914.1 Pan troglodytes
GeneID:839921 ATMRP13 NP_174330.1 Arabidopsis thaliana
GeneID:839922 ATMRP12 NP_174331.2 Arabidopsis thaliana

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 sigma M0318 Anti-MRP3 antibody produced in rabbit ;

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0016021 Component integral to membrane
GO:0005887 Component integral to plasma membrane
GO:0016020 Component membrane
GO:0016887 Function ATPase activity
GO:0042626 Function ATPase activity, coupled to transmembrane movement of substances
GO:0005524 Function ATP binding
GO:0017111 Function nucleoside-triphosphatase activity
GO:0000166 Function nucleotide binding
GO:0005215 Function transporter activity
GO:0015722 Process canalicular bile acid transport
GO:0006810 Process transport

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_029600  UCSC Browser NP_083876

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSMUST00000021231 MI0000240 hsa-miR-198 GGUCCAGAGGGGAGAUAGGUUC
ENSMUST00000021231 MI0003133 hsa-miR-432 UCUUGGAGUAGGUCAUUGGGUGG
ENSMUST00000021231 MI0003593 hsa-miR-548a-3p CAAAACUGGCAAUUACUUUUGC
ENSMUST00000021231 MI0003598 hsa-miR-548a-3p CAAAACUGGCAAUUACUUUUGC
ENSMUST00000021231 MI0003612 hsa-miR-548a-3p CAAAACUGGCAAUUACUUUUGC
ENSMUST00000021231 MI0003569 hsa-miR-563 AGGUUGACAUACGUUUCCC
ENSMUST00000021231 MI0003599 hsa-miR-589 UGAGAACCACGUCUGCUCUGAG
ENSMUST00000021231 MI0003614 hsa-miR-601 UGGUCUAGGAUUGUUGGAGGAG
ENSMUST00000021231 MI0003645 hsa-miR-631 AGACCUGGCCCAGACCUCAGC
ENSMUST00000021231 MI0003653 hsa-miR-638 AGGGAUCGCGGGCGGGUGGCGGCCU
ENSMUST00000021231 MI0003659 hsa-miR-644 AGUGUGGCUUUCUUAGAGC
ENSMUST00000021231 MI0003683 hsa-miR-659 CUUGGUUCAGGGAGGGUCCCCA
ENSMUST00000021231 MI0005116 hsa-miR-765 UGGAGGAGAAGGAAGGUGAUG
ENSMUST00000021231 MI0005533 hsa-miR-890 UACUUGGAAAGGCAUCAGUUG
ENSMUST00000021231 MI0005538 hsa-miR-892b CACUGGCUCCUUUCUGGGUAGA
ENSMUST00000021231 MI0000138 mmu-let-7i UGAGGUAGUAGUUUGUGCUGUU
ENSMUST00000021231 MI0000148 mmu-miR-101a UACAGUACUGUGAUAACUGAA
ENSMUST00000021231 MI0000649 mmu-miR-101b UACAGUACUGUGAUAGCUGAA
ENSMUST00000021231 MI0000587 mmu-miR-103 AGCAGCAUUGUACAGGGCUAUGA
ENSMUST00000021231 MI0000588 mmu-miR-103 AGCAGCAUUGUACAGGGCUAUGA
ENSMUST00000021231 MI0000684 mmu-miR-107 AGCAGCAUUGUACAGGGCUAUCA
ENSMUST00000021231 MI0000169 mmu-miR-145* AUUCCUGGAAAUACUGUUCUUG
ENSMUST00000021231 MI0000170 mmu-miR-146a UGAGAACUGAAUUCCAUGGGUU
ENSMUST00000021231 MI0000171 mmu-miR-149 UCUGGCUCCGUGUCUUCACUCCC
ENSMUST00000021231 MI0000174 mmu-miR-152 UCAGUGCAUGACAGAACUUGG
ENSMUST00000021231 MI0000140 mmu-miR-15b* CGAAUCAUUAUUUGCUGCUCUA
ENSMUST00000021231 MI0000687 mmu-miR-17* ACUGCAGUGAGGGCACUUGUAG
ENSMUST00000021231 MI0000697 mmu-miR-181a-1* ACCAUCGACCGUUGAUUGUACC
ENSMUST00000021231 MI0000224 mmu-miR-182 UUUGGCAAUGGUAGAACUCACACCG
ENSMUST00000021231 MI0000551 mmu-miR-192 CUGACCUAUGAAUUGACAGCC
ENSMUST00000021231 MI0000235 mmu-miR-193 AACUGGCCUACAAAGUCCCAGU
ENSMUST00000021231 MI0005484 mmu-miR-193b AACUGGCCCACAAAGUCCCGCU
ENSMUST00000021231 MI0000248 mmu-miR-205 UCCUUCAUUCCACCGGAGUCUG
ENSMUST00000021231 MI0003536 mmu-miR-20b* ACUGCAGUGUGAGCACUUCUAG
ENSMUST00000021231 MI0000974 mmu-miR-215 AUGACCUAUGAUUUGACAGAC
ENSMUST00000021231 MI0000231 mmu-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENSMUST00000021231 MI0000572 mmu-miR-24 UGGCUCAGUUCAGCAGGAACAG
ENSMUST00000021231 MI0000690 mmu-miR-28* CACUAGAUUGUGAGCUGCUGGA
ENSMUST00000021231 MI0000576 mmu-miR-29a UAGCACCAUCUGAAAUCGGUUA
ENSMUST00000021231 MI0000143 mmu-miR-29b UAGCACCAUUUGAAAUCAGUGUU
ENSMUST00000021231 MI0000712 mmu-miR-29b UAGCACCAUUUGAAAUCAGUGUU
ENSMUST00000021231 MI0000577 mmu-miR-29c UAGCACCAUUUGAAAUCGGUUA
ENSMUST00000021231 MI0000704 mmu-miR-320 AAAAGCUGGGUUGAGAGGGCGA
ENSMUST00000021231 MI0000630 mmu-miR-344 UGAUCUAGCCAAAGCCUGACUGU
ENSMUST00000021231 MI0005495 mmu-miR-344 UGAUCUAGCCAAAGCCUGACUGU
ENSMUST00000021231 MI0000763 mmu-miR-362-5p AAUCCUUGGAACCUAGGUGUGAAU
ENSMUST00000021231 MI0000795 mmu-miR-378 ACUGGACUUGGAGUCAGAAGG
ENSMUST00000021231 MI0001638 mmu-miR-448 UUGCAUAUGUAGGAUGUCCCAU
ENSMUST00000021231 MI0004705 mmu-miR-450b-5p UUUUGCAGUAUGUUCCUGAAUA
ENSMUST00000021231 MI0002405 mmu-miR-470* AACCAGUACCUUUCUGAGAAGA
ENSMUST00000021231 MI0005516 mmu-miR-509-3p UGAUUGACAUUUCUGUAAUGG
ENSMUST00000021231 MI0003518 mmu-miR-540-3p AGGUCAGAGGUCGAUCCUGG
ENSMUST00000021231 MI0004131 mmu-miR-551b GCGACCCAUACUUGGUUUCAG
ENSMUST00000021231 MI0006127 mmu-miR-582-3p CCUGUUGAACAACUGAACCCAA
ENSMUST00000021231 MI0004171 mmu-miR-665 ACCAGGAGGCUGAGGUCCCU
ENSMUST00000021231 MI0004638 mmu-miR-679 GGACUGUGAGGUGACUCUUGGU
ENSMUST00000021231 MI0004654 mmu-miR-689 CGUCCCCGCUCGGCGGGGUCC
ENSMUST00000021231 MI0004655 mmu-miR-689 CGUCCCCGCUCGGCGGGGUCC
ENSMUST00000021231 MI0004687 mmu-miR-703 AAAACCUUCAGAAGGAAAGAA
ENSMUST00000021231 MI0004692 mmu-miR-708* CAACUAGACUGUGAGCUUCUAG
ENSMUST00000021231 MI0004693 mmu-miR-709 GGAGGCAGAGGCAGGAGGA
ENSMUST00000021231 MI0004695 mmu-miR-711 GGGACCCGGGGAGAGAUGUAAG
ENSMUST00000021231 MI0004704 mmu-miR-717 CUCAGACAGAGAUACCUUCUCU
ENSMUST00000021231 MI0005471 mmu-miR-871 UAUUCAGAUUAGUGCCAGUCAUG
ENSMUST00000021231 MI0005472 mmu-miR-879* GCUUAUGGCUUCAAGCUUUCGG
ENSMUST00000021231 MI0005476 mmu-miR-883a-3p UAACUGCAACAGCUCUCAGUAU
ENSMUST00000021231 MI0005477 mmu-miR-883b-3p UAACUGCAACAUCUCUCAGUAU
ENSMUST00000021231 MI0003722 rno-miR-664 UAUUCAUUUACUCCCCAGCCUA
ENSMUST00000021231 MI0003723 rno-miR-664 UAUUCAUUUACUCCCCAGCCUA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Liu JJ, et al. (2008) "Cholangiocyte bile salt transporters in cholesterol gallstone-susceptible and resistant inbred mouse strains." J Gastroenterol Hepatol. 23(10):1596-1602. PMID:18717763
  2. [ + ] Rao A, et al. (2008) "The organic solute transporter alpha-beta, Ostalpha-Ostbeta, is essential for intestinal bile acid transport and homeostasis." Proc Natl Acad Sci U S A. 105(10):3891-3896. PMID:18292224
  3. [ + ] Vlaming ML, et al. (2008) "Impact of Abcc2 (Mrp2) and Abcc3 (Mrp3) on the in vivo elimination of methotrexate and its main toxic metabolite 7-hydroxymethotrexate." Clin Cancer Res. 14(24):8152-8160. PMID:19088030
  4. [ + ] Kruh GD, et al. (2007) "Physiological and pharmacological functions of Mrp2, Mrp3 and Mrp4 as determined from recent studies on gene-disrupted mice." Cancer Metastasis Rev. 26(1):5-14. PMID:17273943
  5. [ + ] van de Wetering K, et al. (2007) "Multidrug resistance proteins 2 and 3 provide alternative routes for hepatic excretion of morphine-glucuronides." Mol Pharmacol. 72(2):387-394. PMID:17485564
  6. [ + ] Fukumoto K, et al. (2007) "Effects of genetic backgrounds on hyperbilirubinemia in radixin-deficient mice due to different expression levels of Mrp3." Biochim Biophys Acta. 1772(3):298-306. PMID:17204408
  7. [ + ] Li Q, et al. (2007) "Targeted ablation of Abcc1 or Abcc3 in Abcc6(-/-) mice does not modify the ectopic mineralization process." Exp Dermatol. 16(10):853-859. PMID:17845218
  8. [ + ] Mazumdar M, et al. (2006) "Tumor formation via loss of a molecular motor protein." Curr Biol. 16(15):1559-1564. PMID:16890532
  9. [ + ] Zelcer N, et al. (2006) "Mice lacking Mrp3 (Abcc3) have normal bile salt transport, but altered hepatic transport of endogenous glucuronides." J Hepatol. 44(4):768-775. PMID:16225954
  10. [ + ] Sebastiani G, et al. (2006) "Mapping genetic modulators of amyloid plaque deposition in TgCRND8 transgenic mice." Hum Mol Genet. 15(15):2313-2323. PMID:16785251
  11. [ + ] Carninci P, et al. (2005) "The transcriptional landscape of the mammalian genome." Science. 309(5740):1559-1563. PMID:16141072
  12. [ + ] Maher JM, et al. (2005) "Tissue distribution and hepatic and renal ontogeny of the multidrug resistance-associated protein (Mrp) family in mice." Drug Metab Dispos. 33(7):947-955. PMID:15802388
  13. [ + ] Belinsky MG, et al. (2005) "Analysis of the in vivo functions of Mrp3." Mol Pharmacol. 68(1):160-168. PMID:15814571
  14. [ + ] McCarthy TC, et al. (2005) "Vitamin D receptor-dependent regulation of colon multidrug resistance-associated protein 3 gene expression by bile acids." J Biol Chem. 280(24):23232-23242. PMID:15824121
  15. [ + ] Zelcer N, et al. (2005) "Mice lacking multidrug resistance protein 3 show altered morphine pharmacokinetics and morphine-6-glucuronide antinociception." Proc Natl Acad Sci U S A. 102(20):7274-7279. PMID:15886284
  16. [ + ] Katayama S, et al. (2005) "Antisense transcription in the mammalian transcriptome." Science. 309(5740):1564-1566. PMID:16141073
  17. [ + ] Manautou JE, et al. (2005) "Altered disposition of acetaminophen in mice with a disruption of the Mrp3 gene." Hepatology. 42(5):1091-1098. PMID:16250050
  18. [ + ] Tanaka Y, et al. (2003) "Expressions of hepatobiliary organic anion transporters and bilirubin-conjugating enzyme in differentiating embryonic stem cells." Biochem Biophys Res Commun. 309(2):324-330. PMID:12951053
  19. [ + ] Bohan A, et al. (2003) "Tumor necrosis factor alpha-dependent up-regulation of Lrh-1 and Mrp3(Abcc3) reduces liver injury in obstructive cholestasis." J Biol Chem. 278(38):36688-36698. PMID:12837754
  20. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  21. [ + ] Okazaki Y, et al. (2002) "Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs." Nature. 420(6915):563-573. PMID:12466851
  22. [ + ] Kawai J, et al. (2001) "Functional annotation of a full-length mouse cDNA collection." Nature. 409(6821):685-690. PMID:11217851
  23. [ + ] Ko MS, et al. (2000) "Large-scale cDNA analysis reveals phased gene expression patterns during preimplantation mouse development." Development. 127(8):1737-1749. PMID:10725249
  24. [ + ] Shibata K, et al. (2000) "RIKEN integrated sequence analysis (RISA) system--384-format sequencing pipeline with 384 multicapillary sequencer." Genome Res. 10(11):1757-1771. PMID:11076861
  25. [ + ] Carninci P, et al. (2000) "Normalization and subtraction of cap-trapper-selected cDNAs to prepare full-length cDNA libraries for rapid discovery of new genes." Genome Res. 10(10):1617-1630. PMID:11042159
  26. [ + ] Carninci P, et al. (1999) "High-efficiency full-length cDNA cloning." Methods Enzymol. 303():19-44. PMID:10349636