0610040J01Rik | GeneID:76261 | Mus musculus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 76261 Official Symbol 0610040J01Rik
Locus N/A Gene Type protein-coding
Synonyms AI662686
Full Name RIKEN cDNA 0610040J01 gene
Description RIKEN cDNA 0610040J01 gene
Chromosome 5 C3.1
Also Known As hypothetical protein LOC76261
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 49537

ID Symbol Protein Species
GeneID:55286 C4orf19 NP_001098099.1 Homo sapiens
GeneID:76261 0610040J01Rik NP_083830.2 Mus musculus
GeneID:498368 LOC498368 NP_001017500.1 Rattus norvegicus
GeneID:511424 LOC511424 XP_588757.3 Bos taurus
GeneID:736131 LOC736131 XP_001135564.1 Pan troglodytes

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_029554  UCSC Browser NP_083830

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSMUST00000081747 MI0003161 hsa-miR-517a AUCGUGCAUCCCUUUAGAGUGU
ENSMUST00000081747 MI0003165 hsa-miR-517b UCGUGCAUCCCUUUAGAGUGUU
ENSMUST00000081747 MI0003174 hsa-miR-517c AUCGUGCAUCCUUUUAGAGUGU
ENSMUST00000081747 MI0003596 hsa-miR-548b-5p AAAAGUAAUUGUGGUUUUGGCC
ENSMUST00000081747 MI0003668 hsa-miR-548d-5p AAAAGUAAUUGUGGUUUUUGCC
ENSMUST00000081747 MI0003671 hsa-miR-548d-5p AAAAGUAAUUGUGGUUUUUGCC
ENSMUST00000081747 MI0003557 hsa-miR-552 AACAGGUGACUGGUUAGACAA
ENSMUST00000081747 MI0003599 hsa-miR-589 UGAGAACCACGUCUGCUCUGAG
ENSMUST00000081747 MI0003647 hsa-miR-632 GUGUCUGCUUCCUGUGGGA
ENSMUST00000081747 MI0003660 hsa-miR-645 UCUAGGCUGGUACUGCUGA
ENSMUST00000081747 MI0000097 hsa-miR-95 UUCAACGGGUAUUUAUUGAGCA
ENSMUST00000081747 MI0000587 mmu-miR-103 AGCAGCAUUGUACAGGGCUAUGA
ENSMUST00000081747 MI0000588 mmu-miR-103 AGCAGCAUUGUACAGGGCUAUGA
ENSMUST00000081747 MI0000684 mmu-miR-107 AGCAGCAUUGUACAGGGCUAUCA
ENSMUST00000081747 MI0000565 mmu-miR-16 UAGCAGCACGUAAAUAUUGGCG
ENSMUST00000081747 MI0000566 mmu-miR-16 UAGCAGCACGUAAAUAUUGGCG
ENSMUST00000081747 MI0000724 mmu-miR-181c AACAUUCAACCUGUCGGUGAGU
ENSMUST00000081747 MI0000225 mmu-miR-183 UAUGGCACUGGUAGAAUUCACU
ENSMUST00000081747 MI0000144 mmu-miR-30a UGUAAACAUCCUCGACUGGAAG
ENSMUST00000081747 MI0000145 mmu-miR-30b UGUAAACAUCCUACACUCAGCU
ENSMUST00000081747 MI0000549 mmu-miR-30d UGUAAACAUCCCCGACUGGAAG
ENSMUST00000081747 MI0000259 mmu-miR-30e UGUAAACAUCCUUGACUGGAAG
ENSMUST00000081747 MI0000609 mmu-miR-331-3p GCCCCUGGGCCUAUCCUAGAA
ENSMUST00000081747 MI0000817 mmu-miR-335-5p UCAAGAGCAAUAACGAAAAAUGU
ENSMUST00000081747 MI0001447 mmu-miR-425 AAUGACACGAUCACUCCCGUUGA
ENSMUST00000081747 MI0004589 mmu-miR-496 UGAGUAUUACAUGGCCAAUCUC
ENSMUST00000081747 MI0003538 mmu-miR-503 UAGCAGCGGGAACAGUACUGCAG
ENSMUST00000081747 MI0005518 mmu-miR-574-3p CACGCUCAUGCACACACCCACA
ENSMUST00000081747 MI0004295 mmu-miR-670 AUCCCUGAGUGUAUGUGGUGAA
ENSMUST00000081747 MI0004682 mmu-miR-698 CAUUCUCGUUUCCUUCCCU

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Carninci P, et al. (2005) "The transcriptional landscape of the mammalian genome." Science. 309(5740):1559-1563. PMID:16141072
  2. [ + ] Katayama S, et al. (2005) "Antisense transcription in the mammalian transcriptome." Science. 309(5740):1564-1566. PMID:16141073
  3. [ + ] Okazaki Y, et al. (2002) "Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs." Nature. 420(6915):563-573. PMID:12466851
  4. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  5. [ + ] Kawai J, et al. (2001) "Functional annotation of a full-length mouse cDNA collection." Nature. 409(6821):685-690. PMID:11217851
  6. [ + ] Carninci P, et al. (2000) "Normalization and subtraction of cap-trapper-selected cDNAs to prepare full-length cDNA libraries for rapid discovery of new genes." Genome Res. 10(10):1617-1630. PMID:11042159
  7. [ + ] Shibata K, et al. (2000) "RIKEN integrated sequence analysis (RISA) system--384-format sequencing pipeline with 384 multicapillary sequencer." Genome Res. 10(11):1757-1771. PMID:11076861
  8. [ + ] Carninci P, et al. (1999) "High-efficiency full-length cDNA cloning." Methods Enzymol. 303():19-44. PMID:10349636