0610007P08Rik | GeneID:76251 | Mus musculus

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 76251 Official Symbol 0610007P08Rik
Locus mCG_113638 Gene Type protein-coding
Synonyms 1700019D06Rik; 9330134C04Rik; MGC100170; Rad26l; Sr278
Full Name RIKEN cDNA 0610007P08 gene
Description RIKEN cDNA 0610007P08 gene
Chromosome 13 B3
Also Known As RAD26L hypothetical protein; putative repair and recombination helicase RAD26L; stretch responsive protein 278
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 32564

ID Symbol Protein Species
GeneID:76251 0610007P08Rik NP_075996.2 Mus musculus
GeneID:361197 RGD1561537 XP_341481.3 Rattus norvegicus
GeneID:375748 C9orf102 NP_001010895.1 Homo sapiens
GeneID:427469 LOC427469 XP_425043.2 Gallus gallus
GeneID:473349 LOC473349 XP_528720.2 Pan troglodytes
GeneID:476297 LOC476297 XP_533502.2 Canis lupus familiaris
GeneID:508669 LOC508669 XP_585480.3 Bos taurus
GeneID:553504 LOC553504 XP_689596.3 Danio rerio
GeneID:100149207 LOC100149207 XP_001918941.1 Danio rerio

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005634 Component nucleus
GO:0005524 Function ATP binding
GO:0008026 Function ATP-dependent helicase activity
GO:0003677 Function DNA binding
GO:0004386 Function helicase activity
GO:0016787 Function hydrolase activity
GO:0003676 Function nucleic acid binding
GO:0000166 Function nucleotide binding
GO:0006281 Process DNA repair
GO:0006974 Process response to DNA damage stimulus

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001013608  UCSC Browser NP_001013626
2 NM_023507  UCSC Browser NP_075996

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSMUST00000095724 MI0005023 bta-miR-545 AUCAACAAACAUUUAUUGUGUG
ENSMUST00000095724 MI0003171 hsa-miR-518d-5p CUCUAGAGGGAAGCACUUUCUG
ENSMUST00000095724 MI0003149 hsa-miR-520a-5p CUCCAGAGGGAAGUACUUUCU
ENSMUST00000095724 MI0003152 hsa-miR-525-5p CUCCAGAGGGAUGCACUUUCU
ENSMUST00000095724 MI0003576 hsa-miR-569 AGUUAAUGAAUCCUGGAAAGU
ENSMUST00000095724 MI0003623 hsa-miR-610 UGAGCUAAAUGUGUGCUGGGA
ENSMUST00000095724 MI0003652 hsa-miR-637 ACUGGGGGCUUUCGGGCUCUGCGU
ENSMUST00000095724 MI0003677 hsa-miR-655 AUAAUACAUGGUUAACCUCUUU
ENSMUST00000095724 MI0003763 hsa-miR-767-3p UCUGCUCAUACCCCAUGGUUUCU
ENSMUST00000095724 MI0005768 hsa-miR-943 CUGACUGUUGCCGUCCUCCAG
ENSMUST00000095724 MI0000152 mmu-miR-125b* ACAAGUCAGGUUCUUGGGACCU
ENSMUST00000095724 MI0000408 mmu-miR-130b* ACUCUUUCCCUGUUGCACUACU
ENSMUST00000095724 MI0000162 mmu-miR-136* AUCAUCGUCUCAAAUGAGUCUU
ENSMUST00000095724 MI0000163 mmu-miR-137 UUAUUGCUUAAGAAUACGCGUAG
ENSMUST00000095724 MI0000223 mmu-miR-181a AACAUUCAACGCUGUCGGUGAGU
ENSMUST00000095724 MI0000697 mmu-miR-181a AACAUUCAACGCUGUCGGUGAGU
ENSMUST00000095724 MI0000723 mmu-miR-181b AACAUUCAUUGCUGUCGGUGGGU
ENSMUST00000095724 MI0000823 mmu-miR-181b AACAUUCAUUGCUGUCGGUGGGU
ENSMUST00000095724 MI0000724 mmu-miR-181c AACAUUCAACCUGUCGGUGAGU
ENSMUST00000095724 MI0005450 mmu-miR-181d AACAUUCAUUGUUGUCGGUGGGU
ENSMUST00000095724 MI0000225 mmu-miR-183 UAUGGCACUGGUAGAAUUCACU
ENSMUST00000095724 MI0000569 mmu-miR-21 UAGCUUAUCAGACUGAUGUUGA
ENSMUST00000095724 MI0000142 mmu-miR-27b* AGAGCUUAGCUGAUUGGUGAAC
ENSMUST00000095724 MI0000144 mmu-miR-30a UGUAAACAUCCUCGACUGGAAG
ENSMUST00000095724 MI0000145 mmu-miR-30b UGUAAACAUCCUACACUCAGCU
ENSMUST00000095724 MI0000547 mmu-miR-30c UGUAAACAUCCUACACUCUCAGC
ENSMUST00000095724 MI0000548 mmu-miR-30c UGUAAACAUCCUACACUCUCAGC
ENSMUST00000095724 MI0000549 mmu-miR-30d UGUAAACAUCCCCGACUGGAAG
ENSMUST00000095724 MI0000595 mmu-miR-324-3p CCACUGCCCCAGGUGCUGCU
ENSMUST00000095724 MI0000623 mmu-miR-340-3p UCCGUCUCAGUUACUUUAUAGC
ENSMUST00000095724 MI0001146 mmu-miR-384-5p UGUAAACAAUUCCUAGGCAAUGU
ENSMUST00000095724 MI0001638 mmu-miR-448 UUGCAUAUGUAGGAUGUCCCAU
ENSMUST00000095724 MI0003534 mmu-miR-487b AAUCGUACAGGGUCAUCCACUU
ENSMUST00000095724 MI0004706 mmu-miR-505 CGUCAACACUUGCUGGUUUUCU
ENSMUST00000095724 MI0003523 mmu-miR-547 CUUGGUACAUCUUUGAGUGAG
ENSMUST00000095724 MI0005519 mmu-miR-590-3p UAAUUUUAUGUAUAAGCUAGU
ENSMUST00000095724 MI0005519 mmu-miR-590-5p GAGCUUAUUCAUAAAAGUGCAG
ENSMUST00000095724 MI0004965 mmu-miR-652 AAUGGCGCCACUAGGGUUGUG
ENSMUST00000095724 MI0004258 mmu-miR-672 UGAGGUUGGUGUACUGUGUGUGA
ENSMUST00000095724 MI0004682 mmu-miR-698 CAUUCUCGUUUCCUUCCCU
ENSMUST00000095724 MI0000728 mmu-miR-7a* CAACAAAUCACAGUCUGCCAUA
ENSMUST00000095724 MI0005548 mmu-miR-878-5p UAUCUAGUUGGAUGUCAAGACA
ENSMUST00000095724 MI0005472 mmu-miR-879 AGAGGCUUAUAGCUCUAAGCC
ENSMUST00000095724 MI0005476 mmu-miR-883a-5p UGCUGAGAGAAGUAGCAGUUAC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Carninci P, et al. (2005) "The transcriptional landscape of the mammalian genome." Science. 309(5740):1559-1563. PMID:16141072
  2. [ + ] Katayama S, et al. (2005) "Antisense transcription in the mammalian transcriptome." Science. 309(5740):1564-1566. PMID:16141073
  3. [ + ] Okazaki Y, et al. (2002) "Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs." Nature. 420(6915):563-573. PMID:12466851
  4. [ + ] Mural RJ, et al. (2002) "A comparison of whole-genome shotgun-derived mouse chromosome 16 and the human genome." Science. 296(5573):1661-1671. PMID:12040188
  5. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  6. [ + ] Kawai J, et al. (2001) "Functional annotation of a full-length mouse cDNA collection." Nature. 409(6821):685-690. PMID:11217851
  7. [ + ] Wheeler DL, et al. (2001) "Database resources of the National Center for Biotechnology Information." Nucleic Acids Res. 29(1):11-16. PMID:11125038
  8. [ + ] Shibata K, et al. (2000) "RIKEN integrated sequence analysis (RISA) system--384-format sequencing pipeline with 384 multicapillary sequencer." Genome Res. 10(11):1757-1771. PMID:11076861
  9. [ + ] Carninci P, et al. (2000) "Normalization and subtraction of cap-trapper-selected cDNAs to prepare full-length cDNA libraries for rapid discovery of new genes." Genome Res. 10(10):1617-1630. PMID:11042159
  10. [ + ] Tanaka TS, et al. (2000) "Genome-wide expression profiling of mid-gestation placenta and embryo using a 15,000 mouse developmental cDNA microarray." Proc Natl Acad Sci U S A. 97(16):9127-9132. PMID:10922068
  11. [ + ] Carninci P, et al. (1999) "High-efficiency full-length cDNA cloning." Methods Enzymol. 303():19-44. PMID:10349636