CA1 | GeneID:759 | Homo sapiens
Gene Summary
[
] NCBI Entrez Gene
| Gene ID | 759 | Official Symbol | CA1 |
|---|---|---|---|
| Locus | N/A | Gene Type | protein-coding |
| Synonyms | Car1 | ||
| Full Name | carbonic anhydrase I | ||
| Description | carbonic anhydrase I | ||
| Chromosome | 8q13-q22.1 | ||
| Also Known As | carbonic dehydratase | ||
| Summary | Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. They show extensive diversity in tissue distribution and in their subcellular localization. CA1 is closely linked to CA2 and CA3 genes on chromosome 8, and it encodes a cytosolic protein which is found at the highest level in erythrocytes. Transcript variants of CA1 utilizing alternative polyA_sites have been described in literature. [provided by RefSeq] | ||
Orthologs and Paralogs
[
] Homologs - NCBI's HomoloGene Group: 20414
| ID | Symbol | Protein | Species |
|---|---|---|---|
| GeneID:759 | CA1 | NP_001729.1 | Homo sapiens |
| GeneID:12346 | Car1 | NP_033929.2 | Mus musculus |
| GeneID:310218 | Car1 | XP_226922.3 | Rattus norvegicus |
| GeneID:464264 | CA1 | XP_519839.1 | Pan troglodytes |
| GeneID:487031 | CA1 | XP_544160.1 | Canis lupus familiaris |
| GeneID:510801 | CA1 | NP_001068934.1 | Bos taurus |
| GeneID:784254 | CA1 | XP_001250684.1 | Bos taurus |
| GeneID:824438 | AT3G52720 | NP_566971.2 | Arabidopsis thaliana |
| GeneID:4329556 | Os02g0533300 | NP_001047030.1 | Oryza sativa |
Antibodies
[
] Monoclonal and Polyclonal Antibodies
| No. | Provider | Product No. | Description |
|---|---|---|---|
| 1 | abcam | ab70418 | Carbonic Anhydrase I antibody [9D6D7] (ab70418); Mouse monoclonal [9D6D7] to Carbonic Anhydrase I |
| 2 | abcam | ab64679 | Carbonic Anhydrase I antibody (ab64679); Sheep polyclonal to Carbonic Anhydrase I |
| 3 | abcam | ab64680 | Carbonic Anhydrase I antibody (FITC) (ab64680); Sheep polyclonal to Carbonic Anhydrase I (FITC) |
| 4 | abcam | ab54912 | Carbonic Anhydrase I antibody (ab54912); Mouse monoclonal to Carbonic Anhydrase I |
| 5 | abcam | ab36275 | Carbonic Anhydrase I antibody (Alkaline Phosphatase) (ab36275); Sheep polyclonal to Carbonic Anhydrase I (Alkaline Phosphatase) |
| 6 | abcam | ab36338 | Carbonic Anhydrase I antibody (ab36338); Sheep polyclonal to Carbonic Anhydrase I |
| 7 | abcam | ab36073 | Carbonic Anhydrase I antibody (ab36073); Rabbit polyclonal to Carbonic Anhydrase I |
| 8 | abcam | ab34978 | Carbonic Anhydrase I antibody (ab34978); Rabbit polyclonal to Carbonic Anhydrase I |
| 9 | abcam | ab34603 | Carbonic Anhydrase I antibody (HRP) (ab34603); Goat polyclonal to Carbonic Anhydrase I (HRP) |
| 10 | abcam | ab34567 | Carbonic Anhydrase I antibody (Biotin) (ab34567); Goat polyclonal to Carbonic Anhydrase I (Biotin) |
| 11 | abcam | ab6618 | Carbonic Anhydrase I antibody (ab6618); Goat polyclonal to Carbonic Anhydrase I |
| 12 | abcam | ab6619 | Carbonic Anhydrase I antibody (ab6619); Goat polyclonal to Carbonic Anhydrase I |
| 13 | acris | R1067B | Carbonic anhydrase 1; antibody Ab |
| 14 | acris | R1067HRP | Carbonic anhydrase 1; antibody Ab |
| 15 | acris | BP324AP | Carbonic anhydrase 1; antibody Ab |
| 16 | acris | BP324 | Carbonic anhydrase 1; antibody Ab |
| 17 | acris | R1067 | Carbonic anhydrase 1; antibody Ab |
| 18 | acris | R1067P | Carbonic anhydrase 1; antibody Ab |
| 19 | acris | AP09434PU-N | Carbonic anhydrase 1 (Internal); antibody Ab |
| 20 | scbt | CA1 | CA1 Antibody / CA1 Antibodies; |
| 21 | sigma | HPA006558 | Anti-CA1 antibody produced in rabbit ; |
Gene Classification
[
] Gene Ontology
| ID | Category | GO Term |
|---|---|---|
| GO:0005737 | Component | cytoplasm |
| GO:0005794 | Component | Golgi apparatus |
| GO:0004089 | Function | carbonate dehydratase activity |
| GO:0016829 | Function | lyase activity |
| GO:0046872 | Function | metal ion binding |
| GO:0008270 | Function | zinc ion binding |
| GO:0006730 | Process | one-carbon compound metabolic process |
RefSeq Isoforms
[
] RefSeq Annotation and UniProt Database
| No. | RefSeq RNA | RefSeq Protein | UniProt Equivalent |
|---|---|---|---|
| 1 | NM_001128829 UCSC Browser | NP_001122301 | |
| 2 | NM_001128830 UCSC Browser | NP_001122302 | |
| 3 | NM_001128831 UCSC Browser | NP_001122303 | |
| 4 | NM_001738 UCSC Browser | NP_001729 | |
MicroRNA and Targets
[
] MicroRNA Sequences and Transcript Targets from miRBase at Sanger
| RNA Target | miRNA # | mat miRNA | Mature miRNA Sequence |
|---|---|---|---|
| ENST00000256119 | MI0000271 | hsa-miR-181c* | AACCAUCGACCGUUGAGUGGAC |
| ENST00000256119 | MI0000273 | hsa-miR-183* | GUGAAUUACCGAAGGGCCAUAA |
| ENST00000256119 | MI0000483 | hsa-miR-186 | CAAAGAAUUCUCCUUUUGGGCU |
| ENST00000256119 | MI0000082 | hsa-miR-25 | CAUUGCACUUGUCUCGGUCUGA |
| ENST00000256119 | MI0001729 | hsa-miR-451 | AAACCGUUACCAUUACUGAGUU |
| ENST00000256119 | MI0003186 | hsa-miR-502-5p | AUCCUUGCUAUCUGGGUGCUA |
| ENST00000256119 | MI0003148 | hsa-miR-519c-3p | AAAGUGCAUCUUUUUAGAGGAU |
| ENST00000256119 | MI0003150 | hsa-miR-526b | CUCUUGAGGGAAGCACUUUCUGU |
| ENST00000256119 | MI0003565 | hsa-miR-559 | UAAAGUAAAUAUGCACCAAAA |
| ENST00000256119 | MI0003567 | hsa-miR-561 | CAAAGUUUAAGAUCCUUGAAGU |
| ENST00000256119 | MI0003602 | hsa-miR-590-5p | GAGCUUAUUCAUAAAAGUGCAG |
| ENST00000256119 | MI0003604 | hsa-miR-592 | UUGUGUCAAUAUGCGAUGAUGU |
| ENST00000256119 | MI0003640 | hsa-miR-626 | AGCUGUCUGAAAAUGUCUU |
| ENST00000256119 | MI0003683 | hsa-miR-659 | CUUGGUUCAGGGAGGGUCCCCA |
| ENST00000256119 | MI0005543 | hsa-miR-708* | CAACUAGACUGUGAGCUUCUAG |
| ENST00000256119 | MI0000093 | hsa-miR-92a | UAUUGCACUUGUCCCGGCCUGU |
| ENST00000256119 | MI0000094 | hsa-miR-92a | UAUUGCACUUGUCCCGGCCUGU |
| ENST00000256119 | MI0003560 | hsa-miR-92b | UAUUGCACUCGUCCCGGCCUCC |
| ENST00000256119 | MI0005769 | hsa-miR-944 | AAAUUAUUGUACAUCGGAUGAG |
| ENST00000256119 | MI0000388 | mmu-miR-290-5p | ACUCAAACUAUGGGGGCACUUU |
| ENST00000256119 | MI0000390 | mmu-miR-292-5p | ACUCAAACUGGGGGCUCUUUUG |
| ENST00000256119 | MI0002398 | mmu-miR-463 | UGAUAGACACCAUAUAAGGUAG |
| ENST00000256119 | MI0005473 | mmu-miR-880 | UACUCCAUCCUCUCUGAGUAGA |
Chemicals and Drugs
[
] Comparative Toxicogenomics Database from MDI Biological Lab
Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
| Chemical and Interaction | |
|---|---|
| bisphenol A | |
|
|
| Bromates | |
|
|
| Carbonates | |
|
|
| chloric acid | |
|
|
| diallyl phthalate | |
|
|
| Iodates | |
|
|
| Nitric Acid | |
|
|
| perchlorate | |
|
|
| potassium periodate | |
|
|
| sodium metasilicate | |
|
|
| sulfamic acid | |
|
|
| Sulfates | |
|
|
| tungstate | |
|
|
| Vanadates | |
|
|
Gene and Diseases
[
] Gene and Diseases [Data source: CTD]
Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
| Disease Name | Relationship | PubMed |
|---|---|---|
| Breast Neoplasms | inferred via bisphenol A | 17123778 |
| Carcinoma in Situ | inferred via bisphenol A | 17123778 |
| Insulin Resistance | inferred via bisphenol A | 16393666 |
| Prostatic Neoplasms | inferred via bisphenol A | 16740699 |
| Substance-Related Disorders | inferred via bisphenol A | 16684133, 16045194 |
| Uterine Diseases | inferred via bisphenol A | 14652134 |
Selected Publications
[
] Gene-related publications indexed at PubMed
- [
] Barbe L, et al. (2008) "Toward a confocal subcellular atlas of the human proteome." Mol Cell Proteomics. 7(3):499-508. PMID:18029348 - [
] Temperini C, et al. (2007) "Phosph(on)ate as a zinc-binding group in metalloenzyme inhibitors: X-ray crystal structure of the antiviral drug foscarnet complexed to human carbonic anhydrase I." Bioorg Med Chem Lett. 17(8):2210-2215. PMID:17314045 - [
] Gambhir KK, et al. (2007) "Decreased total carbonic anhydrase esterase activity and decreased levels of carbonic anhydrase 1 isozyme in erythrocytes of type II diabetic patients." Biochem Genet. 45(5-6):431-439. PMID:17464559 - [
] Temperini C, et al. (2006) "Carbonic anhydrase activators: the first X-ray crystallographic study of an adduct of isoform I." Bioorg Med Chem Lett. 16(19):5152-5156. PMID:16870440 - [
] Kummola L, et al. (2005) "Expression of a novel carbonic anhydrase, CA XIII, in normal and neoplastic colorectal mucosa." BMC Cancer. 5():41. PMID:15836783 - [
] Puccetti L, et al. (2005) "Carbonic anhydrase inhibitors: synthesis and inhibition of cytosolic/tumor-associated carbonic anhydrase isozymes I, II, and IX with sulfonamides incorporating thioureido-sulfanilyl scaffolds." Bioorg Med Chem Lett. 15(9):2359-2364. PMID:15837325 - [
] Mafra D, et al. (2004) "Erythrocyte zinc and carbonic anhydrase levels in nondialyzed chronic kidney disease patients." Clin Biochem. 37(1):67-71. PMID:14675565 - [
] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334 - [
] Ferraroni M, et al. (2002) "Crystal structure of a zinc-activated variant of human carbonic anhydrase I, CA I Michigan 1: evidence for a second zinc binding site involving arginine coordination." Biochemistry. 41(20):6237-6244. PMID:12009884 - [
] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932 - [
] Puscas I, et al. (2001) "Vasoconstrictive drugs increase carbonic anhydrase I in vascular smooth muscle while vasodilating drugs reduce the activity of this isozyme by a direct mechanism of action." Drugs Exp Clin Res. 27(2):53-60. PMID:11392054 - [
] Kivela AJ, et al. (2001) "Differential expression of cytoplasmic carbonic anhydrases, CA I and II, and membrane-associated isozymes, CA IX and XII, in normal mucosa of large intestine and in colorectal tumors." Dig Dis Sci. 46(10):2179-2186. PMID:11680594 - [
] Bekku S, et al. (1998) "Carbonic anhydrase I and II as a differentiation marker of human and rat colonic enterocytes." Res Exp Med (Berl). 198(4):175-185. PMID:9879596 - [
] Sly WS, et al. (1995) "Human carbonic anhydrases and carbonic anhydrase deficiencies." Annu Rev Biochem. 64():375-401. PMID:7574487 - [
] Chegwidden WR, et al. (1994) "Marked zinc activation of ester hydrolysis by a mutation, 67-His (CAT) to Arg (CGT), in the active site of human carbonic anhydrase I." Hum Mutat. 4(4):294-296. PMID:7866410 - [
] Dawson SJ, et al. (1992) "Treatment of Haemophilus aphrophilus endocarditis with ciprofloxacin." J Infect. 24(3):317-320. PMID:1602151 - [
] Lowe N, et al. (1991) "Physical mapping of the human carbonic anhydrase gene cluster on chromosome 8." Genomics. 10(4):882-888. PMID:1916821 - [
] Lowe N, et al. (1990) "Structure and methylation patterns of the gene encoding human carbonic anhydrase I." Gene. 93(2):277-283. PMID:2121614 - [
] Barlow JH, et al. (1987) "Human carbonic anhydrase I cDNA." Nucleic Acids Res. 15(5):2386. PMID:3104879 - [
] Noda Y, et al. (1986) "Immunohistochemical observations on carbonic anhydrase I and II in human salivary glands and submandibular obstructive adenitis." J Oral Pathol. 15(4):187-190. PMID:3088232 - [
] Edwards YH, et al. (1986) "Assignment of the gene determining human carbonic anhydrase, CAI, to chromosome 8." Ann Hum Genet. 50(Pt 2):123-129. PMID:3124707 - [
] Omoto K, et al. (1981) "Population genetic studies of the Philippine Negritos. III. Identification of the carbonic anhydrase-1 variant with CA1 Guam." Am J Hum Genet. 33(1):105-111. PMID:6781336 - [
] Kendall AG, et al. (1977) "Erythrocyte carbonic anhydrase I: inherited deficiency in humans." Science. 197(4302):471-472. PMID:406674 - [
] Tashian RE, et al. (1976) "Biochemical genetics of carbonic anhydrase." Adv Hum Genet. 7():1-56. PMID:827930 - [
] Kannan KK, et al. (1975) "Crystal structure of human erythrocyte carbonic anhydrase B. Three-dimensional structure at a nominal 2.2-A resolution." Proc Natl Acad Sci U S A. 72(1):51-55. PMID:804171 - [
] Lin KT, et al. (1974) "Human carbonic anhydrases. XII. The complete primary structure of the C isozyme." J Biol Chem. 249(8):2329-2337. PMID:4207120 - [
] Giraud N, et al. (1974) "[Primary structure of human B erythrocyte carbonic anhydrase. 3. Sequence of CNBr fragment I and III (residues 149-260)]" Biochimie. 56(8):1031-1043. PMID:4217196 - [
] Lin KT, et al. (1973) "Human carbonic anhydrases. XI. The complete primary structure of carbonic anhydrase B." J Biol Chem. 248(6):1885-1893. PMID:4632246 - [
] Andersson B, et al. (1972) "Amino acid sequence of human erythrocyte carbonic anhydrase B." Biochem Biophys Res Commun. 48(3):670-677. PMID:4625868
Information on protein localization on the subcellular level is important to map and characterize the proteome and to better understand cellular functions of proteins. Here we report on a pilot study of 466 proteins in three human cell lines aimed to allow large scale confocal microscopy analysis using protein-specific antibodies. Approximately 3000 high resolution images were generated, and more than 80% of the analyzed proteins could be classified in one or multiple subcellular compartment(s). The localizations of the proteins showed, in many cases, good agreement with the Gene Ontology localization prediction model. This is the first large scale antibody-based study to localize proteins into subcellular compartments using antibodies and confocal microscopy. The results suggest that this approach might be a valuable tool in conjunction with predictive models for protein localization.
Foscarnet (phosphonoformate trisodium salt), an antiviral used for the treatment of HIV and herpes virus infections, also acts as an activator or inhibitor of the metalloenzyme carbonic anhydrase (CA, EC 4.2.1.1). Interaction of the drug with 11 CA isozymes has been investigated kinetically, and the X-ray structure of its adduct with isoform I (hCA I-foscarnet complex) has been resolved. The first CA inhibitor possessing a phosphonate zinc-binding group is thus evidenced, together with the factors governing recognition of such small molecules by a metalloenzyme active site. Foscarnet is also a clear-cut example of modulator of an enzyme activity which can act either as an activator or inhibitor of a CA isozyme.
In this exploratory study, we investigated total erythrocyte carbonic anhydrase (CA) estrase activity as well as CA I isozyme concentration in patients with diabetes mellitus type II (DM) and healthy individuals of Howard University Hospital community. Total estrase activity of CA was measured spectrophotometrically using p-nitrophenol acetate before and after inhibition with acetazolamide. CA I isozyme was measured by radial immunodiffusion using monoclonal antibody (CA I) in agarose plates. The study involved 20 consented participants; 10 normal (N) and 10 (DM), 21 to 84 years of age. The study was approved by the Howard University Institution Review Board. The CA activity was measured following lysis of cells as U/min/mL and CA I concentration as mg/l. We observed CA activity as 46.3+/-4(N) and 25+/-2.1 (DM) whereas CA I concentration as 1896+/-125 (N) and 1104 +/-63 (DM). We speculate that the change in the CA activity may of fundamental importance in the regulation of intracellular; pH(i) for the basic control of metabolism in diabetes mellitus. Further, we propose that CA activity is a good candidate for a biomarker of diabetes mellitus for the early detection of insulin resistance because the CA activity variation was proportional to the severity of the diabetes.
The X-ray crystallographic structure for the adduct of an activator with human carbonic anhydrase isozyme I (hCA I) is reported. L-Histidine binds deep within the enzyme active site, participating in a network of hydrogen bonds involving its carboxylate moiety and the zinc-bound water molecule, as well as the imidazole of His200, being in van der Waals contacts with Thr199, His200, His64, and His67. This binding is very different from that to the other major cytosolic isozyme hCA II.
BACKGROUND: Carbonic anhydrase (CA) isozymes may have an important role in cancer development. Some isozymes control pH homeostasis in tumors that appears to modulate the behaviour of cancer cells. CA XIII is the newest member of the CA gene family. It is a cytosolic isozyme which is expressed in a number of normal tissues. The present study was designed to investigate CA XIII expression in prospectively collected colorectal tumor samples. METHODS: Both neoplastic and normal tissue specimens were obtained from the same patients. The analyses were performed using CA XIII-specific antibodies and an immunohistochemical staining method. For comparison, the tissue sections were immunostained for other cytosolic isozymes, CA I and II. RESULTS: The results indicated that the expression of CA XIII is down-regulated in tumor cells compared to the normal tissue. The lowest signal was detected in carcinoma samples. This pattern of expression was quite parallel for CA I and II. CONCLUSION: The down-regulation of cytosolic CA I, II and XIII in colorectal cancer may result from reduced levels of a common transcription factor or loss of closely linked CA1, CA2 and CA13 alleles on chromosome 8. Their possible role as tumor suppressors should be further evaluated.
The tumor-associated transmembrane carbonic anhydrase (CA, EC 4.2.1.1) isozyme IX (CA IX) is overexpressed in hypoxic tumors and appears to be involved in acidification of the tumor microenvironment, a process correlated with cancer progression and bad prognosis. The acidification may be reduced by inhibiting the enzyme with potent sulfonamide/sulfamate CA inhibitors. A series of such aromatic sulfonamides incorporating thioureido-sulfanilyl moieties has been prepared and investigated for its interaction with the catalytic domain of the human isozyme hCA IX. The key intermediates in the synthesis were obtained by reacting sulfanilamide, homosulfanilamide, or 4-aminoethylbenzenesulfonamide with 4-acetamido-benzenesulfonyl chloride followed by deacetylation and reaction with thiophosgene. The obtained isothiocyanato sulfonamides were reacted with aliphatic or aromatic primary amines or hydrazines, leading to the corresponding thioureas. Some of these compounds showed excellent inhibitory properties against isozymes I, II, and IX, with several inhibitors also presenting selectivity for the inhibition of CA IX over that of the ubiquitous isozyme CA II. Such sulfonamides may constitute interesting candidates for the development of novel antitumor therapies based on the inhibition of the CA isozymes overexpressed in hypoxic tumors. Due to the highest expression of CA IX in clear renal cell carcinoma and its chemo/radioresistance, our efforts are first of all directed to generate effective therapeutic strategies for the cure of this malignancy.
OBJECTIVE: The aim of the present study was to determine the erythrocyte CAI and CAII concentrations in nondialyzed chronic kidney disease patients, and observe the relationship with acidosis, zinc, anemia, and iron supplementation. METHODS: Erythrocyte CA concentrations were measured in nondialyzed patients (n = 38) using enzyme-linked immunosorbent assays (ELISA). The zinc concentration was determined by atomic absorption spectrophotometer. RESULTS AND CONCLUSIONS: The CA levels were observed to be increased in the patients. The mean erythrocyte zinc concentration was also high and the levels of zinc in plasma were baseline values. Correlation was found between CAI and erythrocytes Zn (r = 0.46; P = 0.003), but there was no correlation with ferritin or pH and bicarbonate. The CA levels did not change after iron supplementation, but the zinc erythrocyte levels were reduced. It is concluded that the CA erythrocyte concentration in CKD patients is increased but this cannot be explained by iron deficiency or acidosis.
The National Institutes of Health's Mammalian Gene Collection (MGC) project was designed to generate and sequence a publicly accessible cDNA resource containing a complete open reading frame (ORF) for every human and mouse gene. The project initially used a random strategy to select clones from a large number of cDNA libraries from diverse tissues. Candidate clones were chosen based on 5'-EST sequences, and then fully sequenced to high accuracy and analyzed by algorithms developed for this project. Currently, more than 11,000 human and 10,000 mouse genes are represented in MGC by at least one clone with a full ORF. The random selection approach is now reaching a saturation point, and a transition to protocols targeted at the missing transcripts is now required to complete the mouse and human collections. Comparison of the sequence of the MGC clones to reference genome sequences reveals that most cDNA clones are of very high sequence quality, although it is likely that some cDNAs may carry missense variants as a consequence of experimental artifact, such as PCR, cloning, or reverse transcriptase errors. Recently, a rat cDNA component was added to the project, and ongoing frog (Xenopus) and zebrafish (Danio) cDNA projects were expanded to take advantage of the high-throughput MGC pipeline.
The human genetic variant carbonic anhydrase I (CA I) Michigan 1 results from a single point mutation that changes His 67 to Arg in a critical region of the active site. This variant of the zinc metalloenzyme appears to be unique in that it possesses an esterase activity that is specifically enhanced by added free zinc ions. We have determined the three-dimensional structure of human CA I Michigan 1 by X-ray crystallography to a resolution of 2.6 A. In the absence of added zinc ions, the mutated residue, Arg 67, points out of the active site, hydrogen bonding with the carboxylate of Asn 69. This contrasts with the orientation of His 67, in the native isozyme, which points into the active site. The orientations of His 94, His 96, and His 119, that coordinate the catalytic zinc ion, and of the catalytically critical Thr 199-Glu 106 hydrogen bonding system, are largely unchanged in the mutant. The structure of an enzyme adduct with a second zinc bound was determined to a resolution of 2.0 A. The second zinc ion is coordinated to His 64, His 200, and Arg 67. This arginine residue reverses its orientation on zinc binding and turns into the active site. The residues at these three positions have been implicated in determining the specific kinetic properties of native CA I. This is, to our knowledge, the first example of a zinc ion coordinating with an arginine residue in a Zn(II) enzyme.
The National Institutes of Health Mammalian Gene Collection (MGC) Program is a multiinstitutional effort to identify and sequence a cDNA clone containing a complete ORF for each human and mouse gene. ESTs were generated from libraries enriched for full-length cDNAs and analyzed to identify candidate full-ORF clones, which then were sequenced to high accuracy. The MGC has currently sequenced and verified the full ORF for a nonredundant set of >9,000 human and >6,000 mouse genes. Candidate full-ORF clones for an additional 7,800 human and 3,500 mouse genes also have been identified. All MGC sequences and clones are available without restriction through public databases and clone distribution networks (see http:mgc.nci.nih.gov).
Carbonic anhydrase (CA) is a zinc enzyme that catalyses the reversible hydration reaction of CO2 and plays a major role in the acid-base balance. We have previously shown that certain vasoconstrictive therapeutic agents increase CA I activity whereas vasodilating drugs reduce the activity of this isozyme by a direct mechanism of action. In this paper we studied the effect of other vasoconstrictive and vasodilating agents on CA I activity in order to elucidate the involvement of vascular smooth muscle CA I in vasoconstrictive and vasodilating processes. We studied the in vitro effects of noradrenaline, prostaglandin F2 alpha, thromboxane A2, leukotriene B4, angiotensin II, vasopressin, indomethacin, prazosin, hydralazine, clonidine, reserpine, prostaglandin I2, indapamide, furosemide, amlodipine, verapamil and irbesartan on purified human red blood cell CA I and vascular smooth muscle CA I isolated from rabbits. In vivo, we selected six groups of five rabbits each, which were administered the following substances in acute experiments: orciprenaline (group 1), desmopressin (group 2), verapamil (group 3), irbesartan (group 4), acetazolamide (group 5) and placebo (control group). Vascular smooth muscle CA I activity and systolic blood pressure were determined and compared with those of the control group. In vitro results showed that all the vasoconstrictive agents studied increased purified and human erythrocyte CA I activity as well as vascular smooth muscle CA I, while vasodilating substances reduced the activity of isozyme by a direct mechanism of action. The same results obtained in vivo showed that activation of vascular smooth muscle CA I increased blood pressure while its inhibition reduced blood pressure. The results of this study suggest that pHi changes, induced by activating or inhibiting CA I in vascular smooth muscle, might be responsible for changes in vascular tonus.
This study compares the localization of carbonic anhydrase isozymes (CA) I and II and that of IX and XII in normal large intestine and in colorectal tumors. Immunohistochemical studies were performed on 69 colorectal lesions. While the normal mucosa of the large intestine showed high expression for CA I and II, the intensity of the immunostaining for both isozymes decreased in benign lesions and was very weak in malignant tumors. The reciprocal pattern of expression observed for these cytoplasmic isozymes and transmembrane CA IX and XII in intestinal tissue specimens supports the suggestion that CA IX and XII may be functionally involved in tumor progression to malignancy and/or in invasion. By contrast, while CA I and II are prominent in normal colorectal mucosa, where they play a role in regulation of pH homeostasis and water and ion transport, loss of expression of these cytoplasmic isozymes consistently accompanies progression to malignant transformation.
Carbonic anhydrase (CA) is an enzyme that is expressed in the intestine and catalyzes the reversible hydration of CO2 in the following reaction: CO2 + H2O<==>H2CO3<==>H(+)+HCO3-. To elucidate the association of CA expression with the differentiation of colonic enterocytes, we investigated the expression and localization of CA using a Northern blotting analysis, Western blotting analysis, and immunohistochemical staining. A Northern blotting analysis revealed an abundant expression of CA I and II mRNA in the colonic epithelial cells. However, the expression of CA III mRNA was not detected. According to the results of immunohistochemical staining of the human colonic mucosa using antisera against CA I and II, both CA I and II were localized on the cytoplasm of non-goblet columnar cells in the upper half of the crypts where more differentiated cells are located. According to the results of immunohistochemical staining of the rat colonic mucosa, neither CA I and II were detected at the new-born stage. The expression of CAs in the upper half of the crypts began to rise from 1 week after birth, and thereafter increased according to the growth of the rats. At 3 weeks after birth, the expression of CAs was almost the same as that of the adult rats. The amount of CA proteins evaluated by a Western blotting analysis revealed that the expression of CAs increased gradually until reaching a maximum level at 6 or 8 weeks. These results therefore suggest that CA I and II appear to be good markers for the differentiation of enterocytes in the colonic mucosa.
Carbonic anhydrases (CAs I-VII) are products of a gene family that encodes seven isozymes and several homologous, CA- related proteins. All seven isozymes have been cloned, sequenced, and mapped, and the intron-exon organization of five genes established. They differ in subcellular localizations, being cytoplasmic (CA I, II, III, and VII), GPI-anchored to plasma membranes of specialized epithelial and endothelial cells (CA IV), in mitochondria (CA V), or in salivary secretions (CA VI). They also differ in kinetic properties, susceptibility to inhibitors, and tissue-specific distribution. Structural and kinetic studies of recombinant natural and mutant CAs have greatly increased our understanding of the structural requirements for catalysis. Studies of the effects of CA inhibitors over many years have implicated CAs in a variety of physiological processes. Analyses of human and animal CA deficiencies provide unique opportunities to understand the individual contributions of different isozymes to these processes.
A patient with Haemophilus aphrophilus endocarditis was successfully treated with ciprofloxacin. The response to treatment with cefotaxime and netilmicin for 12 days was poor but was satisfactory to a 6 weeks' course of ciprofloxacin.
A cluster of genes encoding the three cytoplasmic carbonic anhydrase isozymes CAI, CAII, and CAIII lie on the long arm of chromosome 8 (8q22) in humans. These genes have been mapped using pulsed-field gel electrophoresis. The genes lie in the order CA2, CA3, CA1. CA2 and CA3 are separated by 20 kb and are transcribed in the same direction, away from CA1. CA1 is separated from CA3 by over 80 kb and is transcribed in the direction opposite to CA2 and CA3. The arrangement of the genes is consistent with proposals that the duplication event which gave rise to CA1 predated the duplication which gave rise to CA2 and CA3. The order of these three genes differs from that suggested for the mouse based on recombination frequency.
The gene (CAI) encoding human carbonic anhydrase I (CAI) has been isolated and shown to have a total length of 50 kb. Some 36 kb of this consists of a large intron separating the erythroid-specific promoter from the coding region. A small (54 bp) noncoding exon from within this intron is occasionally found in transcripts. Two different polyadenylation sites have been found, the most distal of which is the most commonly used. Methylation levels near the promoter differ widely in cell lines. In CAI-expressing cells, a region of DNA near the promoter is demethylated in a generally highly methylated background. Surprisingly, non-CAI-expressing cell lines show much lower levels of methylation.
Immunohistochemical identification of carbonic anhydrase I and II (CA-I, CA-II) was made in human major salivary glands and obstructive adenitis in submandibular glands. Normal salivary glands stained the strongest for CA-II in serious acinar cells and were negative in mucous cells. Moderate to strong staining for CA-I and CA-II was found in ductal segments. Submandibular glands with obstructive adenitis exhibited reduced CA-I activity in atrophic acinar cells, but not in ductal elements in the early and intermediate stages of the disorder. In the late stage of the obstructive lesion, CA staining in duct-like structures was moderate; however, almost degenerate ductal cells were negative for CA. During the progression of the degeneration in the obstructive lesion, the CA staining decreased dependent on acinar atrophy. Even after longstanding obstruction of the salivary gland, altered ductal epithelia may retain some of their functions.
A cDNA clone complementary to the mRNA encoding the rabbit erythrocyte specific carbonic anhydrase, CAI, has been used as probe for human CAI sequences in the analysis of DNA from panels of rodent/human somatic cell hybrids. The presence of the human CAI gene in all hybrids correlates with the presence of chromosome 8. Together with published mapping data, this assignment indicates that three CA loci are situated on chromosome 8.
Investigation of blood samples from 277 Mamanwas of northeastern Mindanao, Philippines, confirmed the concentration of the variant carbonic anhydrase-1 (CA1 3N) in this group. The frequency for the variant allele was estimated at .217 +/- .017. It occurs also in the Manobos, the Mongoloid indigenous inhabitants of the same district, although the frequency is low (.019 +/- .008). Survey of samples from other Philippine populations, including the Aeta and the Ifugao of Luzon, failed to find variants. This findings suggests different origins of the Aeta and the Mamanwa, although both are usually referred to as Negritos. The Ca1 3N protein was purified by affinity chromatography using azosulfonamide and rechromatography on a DEAE-Sephadex column. The tryptic peptide pattern of CA1 3N was similar to that of CA1 Guam already reported. Furthermore, amino acid analyses of the tryptic peptides indicated that CA1 3N is characterized by the substitution 253 Gly leads to Arg, confirming the identity of this variant with CA1 Guam. The widespread occurrence of CA1 3 variants in the Western Pacific suggests that this variant was once common in an aboriginal population of this region, from which it was scattered by gene flow.
The virtually complete absence of erythrocyte carbonic anhydrase I is reported in three members of a family from the Greek island of Icaria. Two members with moderately reduced levels are believed to be heterozygous for the deficiency. There are no obvious hematological or renal consequences of the severe deficiency state.
The three-dimensional structure of carbonic anhydrase B (EC 4,2,1,1; carbonate hydro-lyase) from human erythrocytes has been determined to high resolution. Parallel and antiparallel pleated sheet makes up the predominant secondary structure of the enzyme. The tertiary structure is unique for its folding and is very similar to the structure is unique for its folding and is very similar to the structure of the isoenzyme, human erythrocyte carbonic anhydrase C. The essential metal ion, zinc, is firmly bound to the enzyme through three histidyl ligands and located at the bottom of a 12-A deep conical cavity. The zinc ligands are involved in a number of hydrogen bond formations with residues in the immediate vicinity of the active site cavity. Some of the similarities and differences in the sidechain orientation and active site topography of the two isoenzymes are also discussed.

