CA1 | GeneID:759 | Homo sapiens

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 759 Official Symbol CA1
Locus N/A Gene Type protein-coding
Synonyms Car1
Full Name carbonic anhydrase I
Description carbonic anhydrase I
Chromosome 8q13-q22.1
Also Known As carbonic dehydratase
Summary Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. They show extensive diversity in tissue distribution and in their subcellular localization. CA1 is closely linked to CA2 and CA3 genes on chromosome 8, and it encodes a cytosolic protein which is found at the highest level in erythrocytes. Transcript variants of CA1 utilizing alternative polyA_sites have been described in literature. [provided by RefSeq]

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 20414

ID Symbol Protein Species
GeneID:759 CA1 NP_001729.1 Homo sapiens
GeneID:12346 Car1 NP_033929.2 Mus musculus
GeneID:310218 Car1 XP_226922.3 Rattus norvegicus
GeneID:464264 CA1 XP_519839.1 Pan troglodytes
GeneID:487031 CA1 XP_544160.1 Canis lupus familiaris
GeneID:510801 CA1 NP_001068934.1 Bos taurus
GeneID:784254 CA1 XP_001250684.1 Bos taurus
GeneID:824438 AT3G52720 NP_566971.2 Arabidopsis thaliana
GeneID:4329556 Os02g0533300 NP_001047030.1 Oryza sativa

Antibodies

[ - ] Monoclonal and Polyclonal Antibodies

No. Provider Product No. Description
1 abcam ab70418 Carbonic Anhydrase I antibody [9D6D7] (ab70418); Mouse monoclonal [9D6D7] to Carbonic Anhydrase I
2 abcam ab64679 Carbonic Anhydrase I antibody (ab64679); Sheep polyclonal to Carbonic Anhydrase I
3 abcam ab64680 Carbonic Anhydrase I antibody (FITC) (ab64680); Sheep polyclonal to Carbonic Anhydrase I (FITC)
4 abcam ab54912 Carbonic Anhydrase I antibody (ab54912); Mouse monoclonal to Carbonic Anhydrase I
5 abcam ab36275 Carbonic Anhydrase I antibody (Alkaline Phosphatase) (ab36275); Sheep polyclonal to Carbonic Anhydrase I (Alkaline Phosphatase)
6 abcam ab36338 Carbonic Anhydrase I antibody (ab36338); Sheep polyclonal to Carbonic Anhydrase I
7 abcam ab36073 Carbonic Anhydrase I antibody (ab36073); Rabbit polyclonal to Carbonic Anhydrase I
8 abcam ab34978 Carbonic Anhydrase I antibody (ab34978); Rabbit polyclonal to Carbonic Anhydrase I
9 abcam ab34603 Carbonic Anhydrase I antibody (HRP) (ab34603); Goat polyclonal to Carbonic Anhydrase I (HRP)
10 abcam ab34567 Carbonic Anhydrase I antibody (Biotin) (ab34567); Goat polyclonal to Carbonic Anhydrase I (Biotin)
11 abcam ab6618 Carbonic Anhydrase I antibody (ab6618); Goat polyclonal to Carbonic Anhydrase I
12 abcam ab6619 Carbonic Anhydrase I antibody (ab6619); Goat polyclonal to Carbonic Anhydrase I
13 acris R1067B Carbonic anhydrase 1; antibody Ab
14 acris R1067HRP Carbonic anhydrase 1; antibody Ab
15 acris BP324AP Carbonic anhydrase 1; antibody Ab
16 acris BP324 Carbonic anhydrase 1; antibody Ab
17 acris R1067 Carbonic anhydrase 1; antibody Ab
18 acris R1067P Carbonic anhydrase 1; antibody Ab
19 acris AP09434PU-N Carbonic anhydrase 1 (Internal); antibody Ab
20 scbt CA1 CA1 Antibody / CA1 Antibodies;
21 sigma HPA006558 Anti-CA1 antibody produced in rabbit ;

Exon, Intron and UTRs

Exon, Intron and UTRs of CA1 Gene Transcript Isoforms

CpG near TSS

CpG dinucleotides near Transcription Start Site of CA1 Gene

Gene Classification

[ - ] Gene Ontology

IDCategoryGO Term
GO:0005737 Component cytoplasm
GO:0005794 Component Golgi apparatus
GO:0004089 Function carbonate dehydratase activity
GO:0016829 Function lyase activity
GO:0046872 Function metal ion binding
GO:0008270 Function zinc ion binding
GO:0006730 Process one-carbon compound metabolic process

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 NM_001128829  UCSC Browser NP_001122301
2 NM_001128830  UCSC Browser NP_001122302
3 NM_001128831  UCSC Browser NP_001122303
4 NM_001738  UCSC Browser NP_001729

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENST00000256119 MI0000271 hsa-miR-181c* AACCAUCGACCGUUGAGUGGAC
ENST00000256119 MI0000273 hsa-miR-183* GUGAAUUACCGAAGGGCCAUAA
ENST00000256119 MI0000483 hsa-miR-186 CAAAGAAUUCUCCUUUUGGGCU
ENST00000256119 MI0000082 hsa-miR-25 CAUUGCACUUGUCUCGGUCUGA
ENST00000256119 MI0001729 hsa-miR-451 AAACCGUUACCAUUACUGAGUU
ENST00000256119 MI0003186 hsa-miR-502-5p AUCCUUGCUAUCUGGGUGCUA
ENST00000256119 MI0003148 hsa-miR-519c-3p AAAGUGCAUCUUUUUAGAGGAU
ENST00000256119 MI0003150 hsa-miR-526b CUCUUGAGGGAAGCACUUUCUGU
ENST00000256119 MI0003565 hsa-miR-559 UAAAGUAAAUAUGCACCAAAA
ENST00000256119 MI0003567 hsa-miR-561 CAAAGUUUAAGAUCCUUGAAGU
ENST00000256119 MI0003602 hsa-miR-590-5p GAGCUUAUUCAUAAAAGUGCAG
ENST00000256119 MI0003604 hsa-miR-592 UUGUGUCAAUAUGCGAUGAUGU
ENST00000256119 MI0003640 hsa-miR-626 AGCUGUCUGAAAAUGUCUU
ENST00000256119 MI0003683 hsa-miR-659 CUUGGUUCAGGGAGGGUCCCCA
ENST00000256119 MI0005543 hsa-miR-708* CAACUAGACUGUGAGCUUCUAG
ENST00000256119 MI0000093 hsa-miR-92a UAUUGCACUUGUCCCGGCCUGU
ENST00000256119 MI0000094 hsa-miR-92a UAUUGCACUUGUCCCGGCCUGU
ENST00000256119 MI0003560 hsa-miR-92b UAUUGCACUCGUCCCGGCCUCC
ENST00000256119 MI0005769 hsa-miR-944 AAAUUAUUGUACAUCGGAUGAG
ENST00000256119 MI0000388 mmu-miR-290-5p ACUCAAACUAUGGGGGCACUUU
ENST00000256119 MI0000390 mmu-miR-292-5p ACUCAAACUGGGGGCUCUUUUG
ENST00000256119 MI0002398 mmu-miR-463 UGAUAGACACCAUAUAAGGUAG
ENST00000256119 MI0005473 mmu-miR-880 UACUCCAUCCUCUCUGAGUAGA

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]

Mutations and SNPs

[ - ] NCBI's dbSNP

Phenotypes

[ - ] Genes and Diseases - MIM at NCBI

Chemicals and Drugs

[ - ] Comparative Toxicogenomics Database from MDI Biological Lab

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Chemical and Interaction
bisphenol A
  • bisphenol A results in decreased expression of CA1 protein
16603574
Bromates
  • Bromates results in decreased activity of CA1 protein
15664814
Carbonates
  • Carbonates results in decreased activity of CA1 protein
15664814
chloric acid
  • chloric acid results in decreased activity of CA1 protein
15664814
diallyl phthalate
  • diallyl phthalate results in decreased expression of CA1 protein
16603574
Iodates
  • Iodates results in decreased activity of CA1 protein
15664814
Nitric Acid
  • Nitric Acid results in decreased activity of CA1 protein
15664814
perchlorate
  • perchlorate results in decreased activity of CA1 protein
15664814
potassium periodate
  • potassium periodate results in decreased activity of CA1 protein
15664814
sodium metasilicate
  • sodium metasilicate results in decreased activity of CA1 protein
15664814
sulfamic acid
  • sulfamic acid results in decreased activity of CA1 protein
15664814
Sulfates
  • Sulfates results in decreased activity of CA1 protein
15664814
tungstate
  • tungstate results in decreased activity of CA1 protein
15664814
Vanadates
  • Vanadates results in decreased activity of CA1 protein
15664814

Gene and Diseases

[ - ] Gene and Diseases [Data source: CTD]

Curated [chemical–gene interactions|chemical–disease|gene–disease] data were retrieved from the Comparative Toxicogenomics Database (CTD), Mount Desert Island Biological Laboratory, Salisbury Cove, Maine. World Wide Web (URL: http://ctd.mdibl.org/). [Jan. 2009].
Disease Name Relationship PubMed
Breast Neoplasms inferred via bisphenol A 17123778
Carcinoma in Situ inferred via bisphenol A 17123778
Insulin Resistance inferred via bisphenol A 16393666
Prostatic Neoplasms inferred via bisphenol A 16740699
Substance-Related Disorders inferred via bisphenol A 16684133, 16045194
Uterine Diseases inferred via bisphenol A 14652134

Transcript Cluster

[ - ] NCBI's UniGene

Selected Publications

[ - ] Gene-related publications indexed at PubMed

  1. [ + ] Barbe L, et al. (2008) "Toward a confocal subcellular atlas of the human proteome." Mol Cell Proteomics. 7(3):499-508. PMID:18029348
  2. [ + ] Temperini C, et al. (2007) "Phosph(on)ate as a zinc-binding group in metalloenzyme inhibitors: X-ray crystal structure of the antiviral drug foscarnet complexed to human carbonic anhydrase I." Bioorg Med Chem Lett. 17(8):2210-2215. PMID:17314045
  3. [ + ] Gambhir KK, et al. (2007) "Decreased total carbonic anhydrase esterase activity and decreased levels of carbonic anhydrase 1 isozyme in erythrocytes of type II diabetic patients." Biochem Genet. 45(5-6):431-439. PMID:17464559
  4. [ + ] Temperini C, et al. (2006) "Carbonic anhydrase activators: the first X-ray crystallographic study of an adduct of isoform I." Bioorg Med Chem Lett. 16(19):5152-5156. PMID:16870440
  5. [ + ] Kummola L, et al. (2005) "Expression of a novel carbonic anhydrase, CA XIII, in normal and neoplastic colorectal mucosa." BMC Cancer. 5():41. PMID:15836783
  6. [ + ] Puccetti L, et al. (2005) "Carbonic anhydrase inhibitors: synthesis and inhibition of cytosolic/tumor-associated carbonic anhydrase isozymes I, II, and IX with sulfonamides incorporating thioureido-sulfanilyl scaffolds." Bioorg Med Chem Lett. 15(9):2359-2364. PMID:15837325
  7. [ + ] Mafra D, et al. (2004) "Erythrocyte zinc and carbonic anhydrase levels in nondialyzed chronic kidney disease patients." Clin Biochem. 37(1):67-71. PMID:14675565
  8. [ + ] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334
  9. [ + ] Ferraroni M, et al. (2002) "Crystal structure of a zinc-activated variant of human carbonic anhydrase I, CA I Michigan 1: evidence for a second zinc binding site involving arginine coordination." Biochemistry. 41(20):6237-6244. PMID:12009884
  10. [ + ] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932
  11. [ + ] Puscas I, et al. (2001) "Vasoconstrictive drugs increase carbonic anhydrase I in vascular smooth muscle while vasodilating drugs reduce the activity of this isozyme by a direct mechanism of action." Drugs Exp Clin Res. 27(2):53-60. PMID:11392054
  12. [ + ] Kivela AJ, et al. (2001) "Differential expression of cytoplasmic carbonic anhydrases, CA I and II, and membrane-associated isozymes, CA IX and XII, in normal mucosa of large intestine and in colorectal tumors." Dig Dis Sci. 46(10):2179-2186. PMID:11680594
  13. [ + ] Bekku S, et al. (1998) "Carbonic anhydrase I and II as a differentiation marker of human and rat colonic enterocytes." Res Exp Med (Berl). 198(4):175-185. PMID:9879596
  14. [ + ] Sly WS, et al. (1995) "Human carbonic anhydrases and carbonic anhydrase deficiencies." Annu Rev Biochem. 64():375-401. PMID:7574487
  15. [ + ] Chegwidden WR, et al. (1994) "Marked zinc activation of ester hydrolysis by a mutation, 67-His (CAT) to Arg (CGT), in the active site of human carbonic anhydrase I." Hum Mutat. 4(4):294-296. PMID:7866410
  16. [ + ] Dawson SJ, et al. (1992) "Treatment of Haemophilus aphrophilus endocarditis with ciprofloxacin." J Infect. 24(3):317-320. PMID:1602151
  17. [ + ] Lowe N, et al. (1991) "Physical mapping of the human carbonic anhydrase gene cluster on chromosome 8." Genomics. 10(4):882-888. PMID:1916821
  18. [ + ] Lowe N, et al. (1990) "Structure and methylation patterns of the gene encoding human carbonic anhydrase I." Gene. 93(2):277-283. PMID:2121614
  19. [ + ] Barlow JH, et al. (1987) "Human carbonic anhydrase I cDNA." Nucleic Acids Res. 15(5):2386. PMID:3104879
  20. [ + ] Noda Y, et al. (1986) "Immunohistochemical observations on carbonic anhydrase I and II in human salivary glands and submandibular obstructive adenitis." J Oral Pathol. 15(4):187-190. PMID:3088232
  21. [ + ] Edwards YH, et al. (1986) "Assignment of the gene determining human carbonic anhydrase, CAI, to chromosome 8." Ann Hum Genet. 50(Pt 2):123-129. PMID:3124707
  22. [ + ] Omoto K, et al. (1981) "Population genetic studies of the Philippine Negritos. III. Identification of the carbonic anhydrase-1 variant with CA1 Guam." Am J Hum Genet. 33(1):105-111. PMID:6781336
  23. [ + ] Kendall AG, et al. (1977) "Erythrocyte carbonic anhydrase I: inherited deficiency in humans." Science. 197(4302):471-472. PMID:406674
  24. [ + ] Tashian RE, et al. (1976) "Biochemical genetics of carbonic anhydrase." Adv Hum Genet. 7():1-56. PMID:827930
  25. [ + ] Kannan KK, et al. (1975) "Crystal structure of human erythrocyte carbonic anhydrase B. Three-dimensional structure at a nominal 2.2-A resolution." Proc Natl Acad Sci U S A. 72(1):51-55. PMID:804171
  26. [ + ] Lin KT, et al. (1974) "Human carbonic anhydrases. XII. The complete primary structure of the C isozyme." J Biol Chem. 249(8):2329-2337. PMID:4207120
  27. [ + ] Giraud N, et al. (1974) "[Primary structure of human B erythrocyte carbonic anhydrase. 3. Sequence of CNBr fragment I and III (residues 149-260)]" Biochimie. 56(8):1031-1043. PMID:4217196
  28. [ + ] Lin KT, et al. (1973) "Human carbonic anhydrases. XI. The complete primary structure of carbonic anhydrase B." J Biol Chem. 248(6):1885-1893. PMID:4632246
  29. [ + ] Andersson B, et al. (1972) "Amino acid sequence of human erythrocyte carbonic anhydrase B." Biochem Biophys Res Commun. 48(3):670-677. PMID:4625868