9130404D08Rik | GeneID:74549 | Mus musculus
Gene Summary
[
] NCBI Entrez Gene
| Gene ID | 74549 | Official Symbol | 9130404D08Rik |
|---|---|---|---|
| Locus | N/A | Gene Type | protein-coding |
| Synonyms | A930019L04Rik; C77863; C79014; KIAA0892; MGC159271; mKIAA0892 | ||
| Full Name | RIKEN cDNA 9130404D08 gene | ||
| Description | RIKEN cDNA 9130404D08 gene | ||
| Chromosome | 8 C1 | ||
| Also Known As | hypothetical protein LOC74549 | ||
| Summary | N/A | ||
Orthologs and Paralogs
[
] Homologs - NCBI's HomoloGene Group: 12574
| ID | Symbol | Protein | Species |
|---|---|---|---|
| GeneID:23383 | KIAA0892 | NP_056144.3 | Homo sapiens |
| GeneID:41830 | CG4203 | NP_650428.1 | Drosophila melanogaster |
| GeneID:74549 | 9130404D08Rik | NP_083269.3 | Mus musculus |
| GeneID:172598 | mau-2 | NP_492228.1 | Caenorhabditis elegans |
| GeneID:290668 | RGD1308759 | XP_214306.3 | Rattus norvegicus |
| GeneID:428348 | KIAA0892 | XP_425908.2 | Gallus gallus |
| GeneID:455875 | LOC455875 | XP_512526.2 | Pan troglodytes |
| GeneID:484807 | LOC484807 | XP_541923.2 | Canis lupus familiaris |
| GeneID:528175 | LOC528175 | XP_873223.1 | Bos taurus |
| GeneID:794129 | LOC794129 | XP_001334031.2 | Danio rerio |
| GeneID:1281819 | AgaP_AGAP001363 | XP_321782.2 | Anopheles gambiae |
Antibodies
[
] Monoclonal and Polyclonal Antibodies
| No. | Provider | Product No. | Description |
|---|---|---|---|
| 1 | abcam | ab46906 | Scc4 antibody (ab46906); Rabbit polyclonal to Scc4 |
Gene Classification
[
] Gene Ontology
| ID | Category | GO Term |
|---|---|---|
| GO:0005576 | Component | extracellular region |
| GO:0005488 | Function | binding |
MicroRNA and Targets
[
] MicroRNA Sequences and Transcript Targets from miRBase at Sanger
| RNA Target | miRNA # | mat miRNA | Mature miRNA Sequence |
|---|---|---|---|
| ENSMUST00000050561 | MI0003142 | hsa-miR-498 | UUUCAAGCCAGGGGGCGUUUUUC |
| ENSMUST00000050561 | MI0003623 | hsa-miR-610 | UGAGCUAAAUGUGUGCUGGGA |
| ENSMUST00000050561 | MI0005560 | hsa-miR-885-5p | UCCAUUACACUACCCUGCCUCU |
| ENSMUST00000050561 | MI0000725 | mmu-miR-125b-3p | ACGGGUUAGGCUCUUGGGAGCU |
| ENSMUST00000050561 | MI0000646 | mmu-miR-135b | UAUGGCUUUUCAUUCCUAUGUGA |
| ENSMUST00000050561 | MI0000225 | mmu-miR-183 | UAUGGCACUGGUAGAAUUCACU |
| ENSMUST00000050561 | MI0000233 | mmu-miR-191* | GCUGCACUUGGAUUUCGUUCCC |
| ENSMUST00000050561 | MI0000570 | mmu-miR-22 | AAGCUGCCAGUUGAAGAACUGU |
| ENSMUST00000050561 | MI0000141 | mmu-miR-23b | AUCACAUUGCCAGGGAUUACC |
| ENSMUST00000050561 | MI0005494 | mmu-miR-343 | UCUCCCUUCAUGUGCCCAGA |
| ENSMUST00000050561 | MI0000768 | mmu-miR-365 | UAAUGCCCCUAAAAAUCCUUAU |
| ENSMUST00000050561 | MI0001645 | mmu-miR-365 | UAAUGCCCCUAAAAAUCCUUAU |
| ENSMUST00000050561 | MI0003493 | mmu-miR-486 | UCCUGUACUGAGCUGCCCCGAG |
| ENSMUST00000050561 | MI0004295 | mmu-miR-670 | AUCCCUGAGUGUAUGUGGUGAA |
| ENSMUST00000050561 | MI0004611 | mmu-miR-674 | GCACUGAGAUGGGAGUGGUGUA |
| ENSMUST00000050561 | MI0004691 | mmu-miR-707 | CAGUCAUGCCGCUUGCCUACG |
| ENSMUST00000050561 | MI0004695 | mmu-miR-711 | GGGACCCGGGGAGAGAUGUAAG |
| ENSMUST00000050561 | MI0004516 | mmu-miR-763 | CCAGCUGGGAAGAACCAGUGGC |
| ENSMUST00000050561 | MI0004310 | mmu-miR-764-3p | AGGAGGCCAUAGUGGCAACUGU |
| ENSMUST00000050561 | MI0005550 | mmu-miR-873 | GCAGGAACUUGUGAGUCUCCU |
Selected Publications
[
] Gene-related publications indexed at PubMed
- [
] Carninci P, et al. (2005) "The transcriptional landscape of the mammalian genome." Science. 309(5740):1559-1563. PMID:16141072 - [
] Katayama S, et al. (2005) "Antisense transcription in the mammalian transcriptome." Science. 309(5740):1564-1566. PMID:16141073 - [
] Blackshaw S, et al. (2004) "Genomic analysis of mouse retinal development." PLoS Biol. 2(9):E247. PMID:15226823 - [
] Gerhard DS, et al. (2004) "The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC)." Genome Res. 14(10B):2121-2127. PMID:15489334 - [
] Okazaki Y, et al. (2002) "Analysis of the mouse transcriptome based on functional annotation of 60,770 full-length cDNAs." Nature. 420(6915):563-573. PMID:12466851 - [
] Strausberg RL, et al. (2002) "Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences." Proc Natl Acad Sci U S A. 99(26):16899-16903. PMID:12477932 - [
] Kawai J, et al. (2001) "Functional annotation of a full-length mouse cDNA collection." Nature. 409(6821):685-690. PMID:11217851 - [
] Ko MS, et al. (2000) "Large-scale cDNA analysis reveals phased gene expression patterns during preimplantation mouse development." Development. 127(8):1737-1749. PMID:10725249 - [
] Tanaka TS, et al. (2000) "Genome-wide expression profiling of mid-gestation placenta and embryo using a 15,000 mouse developmental cDNA microarray." Proc Natl Acad Sci U S A. 97(16):9127-9132. PMID:10922068 - [
] Carninci P, et al. (2000) "Normalization and subtraction of cap-trapper-selected cDNAs to prepare full-length cDNA libraries for rapid discovery of new genes." Genome Res. 10(10):1617-1630. PMID:11042159 - [
] Shibata K, et al. (2000) "RIKEN integrated sequence analysis (RISA) system--384-format sequencing pipeline with 384 multicapillary sequencer." Genome Res. 10(11):1757-1771. PMID:11076861 - [
] Carninci P, et al. (1999) "High-efficiency full-length cDNA cloning." Methods Enzymol. 303():19-44. PMID:10349636 - [
] Bonaldo MF, et al. (1996) "Normalization and subtraction: two approaches to facilitate gene discovery." Genome Res. 6(9):791-806. PMID:8889548
This study describes comprehensive polling of transcription start and termination sites and analysis of previously unidentified full-length complementary DNAs derived from the mouse genome. We identify the 5' and 3' boundaries of 181,047 transcripts with extensive variation in transcripts arising from alternative promoter usage, splicing, and polyadenylation. There are 16,247 new mouse protein-coding transcripts, including 5154 encoding previously unidentified proteins. Genomic mapping of the transcriptome reveals transcriptional forests, with overlapping transcription on both strands, separated by deserts in which few transcripts are observed. The data provide a comprehensive platform for the comparative analysis of mammalian transcriptional regulation in differentiation and development.
Antisense transcription (transcription from the opposite strand to a protein-coding or sense strand) has been ascribed roles in gene regulation involving degradation of the corresponding sense transcripts (RNA interference), as well as gene silencing at the chromatin level. Global transcriptome analysis provides evidence that a large proportion of the genome can produce transcripts from both strands, and that antisense transcripts commonly link neighboring "genes" in complex loci into chains of linked transcriptional units. Expression profiling reveals frequent concordant regulation of sense/antisense pairs. We present experimental evidence that perturbation of an antisense RNA can alter the expression of sense messenger RNAs, suggesting that antisense transcription contributes to control of transcriptional outputs in mammals.
The vertebrate retina is comprised of seven major cell types that are generated in overlapping but well-defined intervals. To identify genes that might regulate retinal development, gene expression in the developing retina was profiled at multiple time points using serial analysis of gene expression (SAGE). The expression patterns of 1,051 genes that showed developmentally dynamic expression by SAGE were investigated using in situ hybridization. A molecular atlas of gene expression in the developing and mature retina was thereby constructed, along with a taxonomic classification of developmental gene expression patterns. Genes were identified that label both temporal and spatial subsets of mitotic progenitor cells. For each developing and mature major retinal cell type, genes selectively expressed in that cell type were identified. The gene expression profiles of retinal Muller glia and mitotic progenitor cells were found to be highly similar, suggesting that Muller glia might serve to produce multiple retinal cell types under the right conditions. In addition, multiple transcripts that were evolutionarily conserved that did not appear to encode open reading frames of more than 100 amino acids in length ("noncoding RNAs") were found to be dynamically and specifically expressed in developing and mature retinal cell types. Finally, many photoreceptor-enriched genes that mapped to chromosomal intervals containing retinal disease genes were identified. These data serve as a starting point for functional investigations of the roles of these genes in retinal development and physiology.
The National Institutes of Health's Mammalian Gene Collection (MGC) project was designed to generate and sequence a publicly accessible cDNA resource containing a complete open reading frame (ORF) for every human and mouse gene. The project initially used a random strategy to select clones from a large number of cDNA libraries from diverse tissues. Candidate clones were chosen based on 5'-EST sequences, and then fully sequenced to high accuracy and analyzed by algorithms developed for this project. Currently, more than 11,000 human and 10,000 mouse genes are represented in MGC by at least one clone with a full ORF. The random selection approach is now reaching a saturation point, and a transition to protocols targeted at the missing transcripts is now required to complete the mouse and human collections. Comparison of the sequence of the MGC clones to reference genome sequences reveals that most cDNA clones are of very high sequence quality, although it is likely that some cDNAs may carry missense variants as a consequence of experimental artifact, such as PCR, cloning, or reverse transcriptase errors. Recently, a rat cDNA component was added to the project, and ongoing frog (Xenopus) and zebrafish (Danio) cDNA projects were expanded to take advantage of the high-throughput MGC pipeline.
Only a small proportion of the mouse genome is transcribed into mature messenger RNA transcripts. There is an international collaborative effort to identify all full-length mRNA transcripts from the mouse, and to ensure that each is represented in a physical collection of clones. Here we report the manual annotation of 60,770 full-length mouse complementary DNA sequences. These are clustered into 33,409 'transcriptional units', contributing 90.1% of a newly established mouse transcriptome database. Of these transcriptional units, 4,258 are new protein-coding and 11,665 are new non-coding messages, indicating that non-coding RNA is a major component of the transcriptome. 41% of all transcriptional units showed evidence of alternative splicing. In protein-coding transcripts, 79% of splice variations altered the protein product. Whole-transcriptome analyses resulted in the identification of 2,431 sense-antisense pairs. The present work, completely supported by physical clones, provides the most comprehensive survey of a mammalian transcriptome so far, and is a valuable resource for functional genomics.
The National Institutes of Health Mammalian Gene Collection (MGC) Program is a multiinstitutional effort to identify and sequence a cDNA clone containing a complete ORF for each human and mouse gene. ESTs were generated from libraries enriched for full-length cDNAs and analyzed to identify candidate full-ORF clones, which then were sequenced to high accuracy. The MGC has currently sequenced and verified the full ORF for a nonredundant set of >9,000 human and >6,000 mouse genes. Candidate full-ORF clones for an additional 7,800 human and 3,500 mouse genes also have been identified. All MGC sequences and clones are available without restriction through public databases and clone distribution networks (see http:mgc.nci.nih.gov).
The RIKEN Mouse Gene Encyclopaedia Project, a systematic approach to determining the full coding potential of the mouse genome, involves collection and sequencing of full-length complementary DNAs and physical mapping of the corresponding genes to the mouse genome. We organized an international functional annotation meeting (FANTOM) to annotate the first 21,076 cDNAs to be analysed in this project. Here we describe the first RIKEN clone collection, which is one of the largest described for any organism. Analysis of these cDNAs extends known gene families and identifies new ones.
Little is known about gene action in the preimplantation events that initiate mammalian development. Based on cDNA collections made from each stage from egg to blastocyst, 25438 3'-ESTs were derived, and represent 9718 genes, half of them novel. Thus, a considerable fraction of mammalian genes is dedicated to embryonic expression. This study reveals profound changes in gene expression that include the transient induction of transcripts at each stage. These results raise the possibility that development is driven by the action of a series of stage-specific expressed genes. The new genes, 798 of them placed on the mouse genetic map, provide entry points for analyses of human and mouse developmental disorders.
cDNA microarray technology has been increasingly used to monitor global gene expression patterns in various tissues and cell types. However, applications to mammalian development have been hampered by the lack of appropriate cDNA collections, particularly for early developmental stages. To overcome this problem, a PCR-based cDNA library construction method was used to derive 52,374 expressed sequence tags from pre- and peri-implantation embryos, embryonic day (E) 12.5 female gonad/mesonephros, and newborn ovary. From these cDNA collections, a microarray representing 15,264 unique genes (78% novel and 22% known) was assembled. In initial applications, the divergence of placental and embryonic gene expression profiles was assessed. At stage E12.5 of development, based on triplicate experiments, 720 genes (6.5%) displayed statistically significant differences in expression between placenta and embryo. Among 289 more highly expressed in placenta, 61 placenta-specific genes encoded, for example, a novel prolactin-like protein. The number of genes highly expressed (and frequently specific) for placenta has thereby been increased 5-fold over the total previously reported, illustrating the potential of the microarrays for tissue-specific gene discovery and analysis of mammalian developmental programs.
In the effort to prepare the mouse full-length cDNA encyclopedia, we previously developed several techniques to prepare and select full-length cDNAs. To increase the number of different cDNAs, we introduce here a strategy to prepare normalized and subtracted cDNA libraries in a single step. The method is based on hybridization of the first-strand, full-length cDNA with several RNA drivers, including starting mRNA as the normalizing driver and run-off transcripts from minilibraries containing highly expressed genes, rearrayed clones, and previously sequenced cDNAs as subtracting drivers. Our method keeps the proportion of full-length cDNAs in the subtracted/normalized library high. Moreover, our method dramatically enhances the discovery of new genes as compared to results obtained by using standard, full-length cDNA libraries. This procedure can be extended to the preparation of full-length cDNA encyclopedias from other organisms.
The RIKEN high-throughput 384-format sequencing pipeline (RISA system) including a 384-multicapillary sequencer (the so-called RISA sequencer) was developed for the RIKEN mouse encyclopedia project. The RISA system consists of colony picking, template preparation, sequencing reaction, and the sequencing process. A novel high-throughput 384-format capillary sequencer system (RISA sequencer system) was developed for the sequencing process. This system consists of a 384-multicapillary auto sequencer (RISA sequencer), a 384-multicapillary array assembler (CAS), and a 384-multicapillary casting device. The RISA sequencer can simultaneously analyze 384 independent sequencing products. The optical system is a scanning system chosen after careful comparison with an image detection system for the simultaneous detection of the 384-capillary array. This scanning system can be used with any fluorescent-labeled sequencing reaction (chain termination reaction), including transcriptional sequencing based on RNA polymerase, which was originally developed by us, and cycle sequencing based on thermostable DNA polymerase. For long-read sequencing, 380 out of 384 sequences (99.2%) were successfully analyzed and the average read length, with more than 99% accuracy, was 654.4 bp. A single RISA sequencer can analyze 216 kb with >99% accuracy in 2.7 h (90 kb/h). For short-read sequencing to cluster the 3' end and 5' end sequencing by reading 350 bp, 384 samples can be analyzed in 1.5 h. We have also developed a RISA inoculator, RISA filtrator and densitometer, RISA plasmid preparator which can handle throughput of 40,000 samples in 17.5 h, and a high-throughput RISA thermal cycler which has four 384-well sites. The combination of these technologies allowed us to construct the RISA system consisting of 16 RISA sequencers, which can process 50,000 DNA samples per day. One haploid genome shotgun sequence of a higher organism, such as human, mouse, rat, domestic animals, and plants, can be revealed by seven RISA systems within one month.
Large-scale sequencing of cDNAs randomly picked from libraries has proven to be a very powerful approach to discover (putatively) expressed sequences that, in turn, once mapped, may greatly expedite the process involved in the identification and cloning of human disease genes. However, the integrity of the data and the pace at which novel sequences can be identified depends to a great extent on the cDNA libraries that are used. Because altogether, in a typical cell, the mRNAs of the prevalent and intermediate frequency classes comprise as much as 50-65% of the total mRNA mass, but represent no more than 1000-2000 different mRNAs, redundant identification of mRNAs of these two frequency classes is destined to become overwhelming relatively early in any such random gene discovery programs, thus seriously compromising their cost-effectiveness. With the goal of facilitating such efforts, previously we developed a method to construct directionally cloned normalized cDNA libraries and applied it to generate infant brain (INIB) and fetal liver/spleen (INFLS) libraries, from which a total of 45,192 and 86,088 expressed sequence tags, respectively, have been derived. While improving the representation of the longest cDNAs in our libraries, we developed three additional methods to normalize cDNA libraries and generated over 35 libraries, most of which have been contributed to our integrated Molecular Analysis of Genomes and Their Expression (IMAGE) Consortium and thus distributed widely and used for sequencing and mapping. In an attempt to facilitate the process of gene discovery further, we have also developed a subtractive hybridization approach designed specifically to eliminate (or reduce significantly the representation of) large pools of arrayed and (mostly) sequenced clones from normalized libraries yet to be (or just partly) surveyed. Here we present a detailed description and a comparative analysis of four methods that we developed and used to generate normalize cDNA libraries from human (15), mouse (3), rat (2), as well as the parasite Schistosoma mansoni (1). In addition, we describe the construction and preliminary characterization of a subtracted liver/spleen library (INFLS-SI) that resulted from the elimination (or reduction of representation) of -5000 INFLS-IMAGE clones from the INFLS library.