ABCC6 | GeneID:742522 | Pan troglodytes

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 742522 Official Symbol ABCC6
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description ATP-binding cassette, sub-family C (CFTR/MRP), member 6
Chromosome N/A
Also Known As
Summary N/A

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_001145741 XP_001145741

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSPTRT00000014398 MI0000814 hsa-miR-338-3p UCCAGCAUCAGUGAUUUUGUUG
ENSPTRT00000014398 MI0001652 hsa-miR-450a UUUUGCGAUGUGUUCCUAAUAU
ENSPTRT00000014398 MI0003187 hsa-miR-450a UUUUGCGAUGUGUUCCUAAUAU
ENSPTRT00000014398 MI0005531 hsa-miR-450b-5p UUUUGCAAUAUGUUCCUGAAUA
ENSPTRT00000014398 MI0003604 hsa-miR-592 UUGUGUCAAUAUGCGAUGAUGU
ENSPTRT00000014398 MI0003611 hsa-miR-599 GUUGUGUCAGUUUAUCAAAC
ENSPTRT00000014398 MI0003651 hsa-miR-636 UGUGCUUGCUCGUCCCGCCCGCA
ENSPTRT00000014398 MI0003760 hsa-miR-671-3p UCCGGUUCUCAGGGCUCCACC
ENSPTRT00000014398 MI0005559 hsa-miR-744 UGCGGGGCUAGGGCUAACAGCA
ENSPTRT00000014398 MI0003836 hsa-miR-766 ACUCCAGCCCCACAGCCUCAGC
ENSPTRT00000014398 MI0002401 mmu-miR-466a-3p UAUACAUACACGCACACAUAAGA
ENSPTRT00000014398 MI0005504 mmu-miR-466b-3-3p AAUACAUACACGCACACAUAAGA
ENSPTRT00000014398 MI0005502 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENSPTRT00000014398 MI0005503 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENSPTRT00000014398 MI0005504 mmu-miR-466b-5p GAUGUGUGUGUACAUGUACAUG
ENSPTRT00000014398 MI0005546 mmu-miR-466d-3p UAUACAUACACGCACACAUAG
ENSPTRT00000014398 MI0005507 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENSPTRT00000014398 MI0005508 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENSPTRT00000014398 MI0005509 mmu-miR-466f-3p CAUACACACACACAUACACAC
ENSPTRT00000014398 MI0005507 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENSPTRT00000014398 MI0005508 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENSPTRT00000014398 MI0005509 mmu-miR-466f-5p UACGUGUGUGUGCAUGUGCAUG
ENSPTRT00000014398 MI0004306 mmu-miR-761 GCAGCAGGGUGAAACUGACACA
ENSPTRT00000014398 MI0002873 ptr-miR-218 UUGUGCUUGAUCUAACCAUGU
ENSPTRT00000014398 MI0002879 ptr-miR-218 UUGUGCUUGAUCUAACCAUGU
ENSPTRT00000014398 MI0002672 ptr-miR-31 GGCAAGAUGCUGGCAUAGCUG

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]