A1BG | GeneID:742390 | Pan troglodytes

Gene Summary

[ - ] NCBI Entrez Gene

Gene ID 742390 Official Symbol A1BG
Locus N/A Gene Type protein-coding
Synonyms
Full Name N/A
Description alpha-1-B glycoprotein
Chromosome N/A
Also Known As alpha 1B-glycoprotein
Summary N/A

Orthologs and Paralogs

[ - ] Homologs - NCBI's HomoloGene Group: 11167

ID Symbol Protein Species
GeneID:1 A1BG NP_570602.2 Homo sapiens
GeneID:117586 A1bg NP_001074536.1 Mus musculus
GeneID:140656 A1bg NP_071594.2 Rattus norvegicus
GeneID:484230 A1BG XP_541346.2 Canis lupus familiaris
GeneID:518955 A1BG NP_001039708.1 Bos taurus
GeneID:742390 A1BG XP_001146598.1 Pan troglodytes

RefSeq Isoforms

[ - ] RefSeq Annotation and UniProt Database

No. RefSeq RNA RefSeq Protein UniProt Equivalent
1 XM_001146459 XP_001146459
2 XM_001146534 XP_001146534
3 XM_001146598 XP_001146598
4 XM_001146669 XP_001146669

MicroRNA and Targets

[ - ] MicroRNA Sequences and Transcript Targets from miRBase at Sanger

RNA Target miRNA # mat miRNA Mature miRNA Sequence
ENSPTRT00000021598 MI0000775 hsa-miR-367 AAUUGCACUUUAGCAAUGGUGA
ENSPTRT00000021598 MI0003124 hsa-miR-489 GUGACAUCACAUAUACGGCAGC
ENSPTRT00000021598 MI0004684 mmu-miR-700 CACGCGGGAACCGAGUCCACC

Transcript Sequences

[ - ] Transcript Accession Number Cloud [ GenBank ]

Protein Sequences

[ - ] Protein Accession Number Cloud [ GenPept ]